{ "cells": [ { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "# Intro to Genomic Data Science\n", "---" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "Source: DNA Wallpaper Cave\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "This introductory tutorial on applying machine learning to bioinformatics data will be broken up into two parts:\n", "\n", "1) [Data Acquisition & Preprocessing](https://towardsdatascience.com/analyzing-microbiome-data-320728b56b8e)\n", " - Where do we find public genomic data sets?\n", " - How do we download them?\n", " - How do we interpret this data biophysically?\n", " - How do we clean and preprocess this data?\n", "\n", "\n", "\n", "2) [Visualizing High-Dimensional Data](https://towardsdatascience.com/visualizing-high-dimensional-microbiome-data-eacf02526c3a)\n", " - How do we visualize high-dimensional data?\n", " - What kinds of dimensionality reduction techniques are appropriate?\n", " - Why do we want to use unsupervised methods before other ML techniques?\n", "\n", "(see corresponding links for expanded Medium articles written by my colleague and I)\n", "\n", "---" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "### Background" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "Macroscopic Ecological Biomes\n", "\n", "\n", "\n", "Source: Impact Lab\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "When we think of different ecosystems such as deserts, rainforests, grasslands, or coral reefs, we know that different communities of organisms are specialized to live in those areas of the world. \n", "\n", "But while many of us spend the majority of our time indoors, few of us realize the extent to which every surface we touch is home to specialized organisms that colonize those spaces — doorknobs, kitchen counters, tables, chairs, bathrooms, refrigerators, etc. " ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "Microscopic Biomes ~ Microbiomes\n", "\n", "\n", "\n", "Source: Syracuse University\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Similar to our macroscopic world of deserts, rainforests, and grasslands, at the microscopic level we can infer that different compositions or groups of microorganisms and fungi may be specialized to live in different locations or surfaces around us. \n", "\n", "We call these special communities of microorganisms a [Microbiome](https://en.wikipedia.org/wiki/Microbiota)." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "Source: Compliance Services\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "### Our Task\n", "\n", "What if we solely knew the genetic differences between these communities of organisms? \n", "\n", "Could we perhaps reverse engineer the location of where these organisms came from using genetic sequence data and some simple data science detective work?\n", "\n", "---" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "### Where to find genomic data?" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "To investigate the genetic differences between microbiomes we were able to find a data set using [Qiita](https://qiita.ucsd.edu/static/doc/html/index.html)." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "Source: Qiita\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Qiita (pronounced ‘cheetah’) is a multi-omics software package and database that holds microbial ecology datasets and offers:\n", "- A nice interface to search for different types of -omics data\n", "- Ability to find reference data from papers\n", "- Info regarding file types and associated metadata\n", "\n", "It is based on the [QIIME](https://en.wikipedia.org/wiki/QIIME) bioinformatics pipeline that transforms and processes raw sequencing data to common formats that are friendly to data analysis. \n", "\n", "Other common bioinformatics pipelines are MOTHUR, DADA2, and USEARCH, etc. For a comparison of the different pipelines, [see here](https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0227434)." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### Acquiring the Data" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "To access the data* you’ll need to create an account and then [download the data](https://qiita.ucsd.edu/study/description/10423) (~6.4 GB) collected by the [Caporaso Lab](https://caporasolab.us/) at the Pathogen & Microbiome Institute from Northern Arizona University, by clicking on the *All QIIME maps and BIOMs* on the left-hand side." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "Source: Caporaso Lab, Northern Arizona University\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Once done*, you’ll need to:\n", "1) Unzip the file\n", "2) Place it in a folder called *data*\n", "3) Transform the data into a format we can work with using a package called [biom-format](https://biom-format.org/).\n", "\n", "In step 3, we can convert .BIOM files to .tsv by running the following two commands inside this notebook, or alternatively on your terminal without the \"%\". \n", "\n", "*For the sake of ease & brevity, I have uploaded a preprocessed version of the data set used in the first part of this tutorial. The .tsv file can be [obtained here](https://drive.google.com/file/d/19GYJK87j3SS9AWUnQoqxkcDjyH7LOtvd/view?usp=sharing). (~94 KB)" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "%pip install biom-format\n", "\n", "%biom convert -i data/BIOM/60899/all.biom -o data/BIOM/60899/feature_table.tsv — to-tsv" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### Reading in our data" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "This command will convert our .biom files to a more familiar .tsv format, from which we can then go into our Jupyter notebook and read into a Pandas dataframe by:" ] }, { "cell_type": "code", "execution_count": 3, "metadata": {}, "outputs": [ { "name": "stderr", "output_type": "stream", "text": [ "C:\\Users\\reimermo\\AppData\\Local\\Temp\\ipykernel_22956\\325096155.py:3: DtypeWarning: Columns (1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145,146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161,162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177,178,179,180,181,182,183,184,185,186,187,188,189,190,191,192,193,194,195,196,197,198,199,200,201,202,203,204,205,206,207,208,209,210,211,212,213,214,215,216,217,218,219,220,221,222,223,224,225,226,227,228,229,230,231,232,233,234,235,236,237,238,239,240,241,242,243,244,245,246,247,248,249,250,251,252,253,254,255,256,257,258,259,260,261,262,263,264,265,266,267,268,269,270,271,272,273,274,275,276,277,278,279,280,281,282,283,284,285,286,287,288,289,290,291,292,293,294,295,296,297,298,299,300,301,302,303,304,305,306,307,308,309,310,311,312,313,314,315,316,317,318,319,320,321,322,323,324,325,326,327,328,329,330,331,332,333,334,335,336,337,338,339,340,341,342,343,344,345,346,347,348,349,350,351,352,353,354,355,356,357,358,359,360,361,362,363,364,365,366,367,368,369,370,371,372,373,374,375,376,377,378,379,380,381,382,383,384,385,386,387,388,389,390,391,392,393,394,395,396,397,398,399,400,401,402,403,404,405,406,407,408,409,410,411,412,413,414,415,416,417,418,419,420,421,422,423,424,425,426,427,428,429,430,431,432,433,434,435,436,437,438,439,440,441,442,443,444,445,446,447,448,449,450,451,452,453,454,455,456,457,458,459,460,461,462,463,464,465,466,467,468,469,470,471,472,473,474,475,476,477,478,479,480,481,482,483,484,485,486,487,488,489,490,491,492,493,494,495,496,497,498,499,500,501,502,503,504,505,506,507,508,509,510,511,512,513,514,515,516,517,518,519,520,521,522,523,524,525,526,527,528,529,530,531,532,533,534,535,536,537,538,539,540,541,542,543,544,545,546,547,548,549,550,551,552,553,554,555,556,557,558,559,560,561,562,563,564,565,566,567,568,569,570,571,572,573,574,575,576,577,578,579,580,581,582,583,584,585,586,587,588,589,590,591,592,593,594,595,596,597,598,599,600,601,602,603,604,605,606,607,608,609,610,611,612,613,614,615,616,617,618,619,620,621,622,623,624,625,626,627,628,629,630,631,632,633,634,635,636,637,638,639,640,641,642,643,644,645,646,647,648,649,650,651,652,653,654,655,656,657,658,659,660,661,662,663,664,665,666,667,668,669,670,671,672,673,674,675,676,677,678,679,680,681,682,683,684,685,686,687,688,689,690,691,692,693,694,695,696,697,698,699,700,701,702,703,704,705,706,707,708,709,710,711,712,713,714,715,716,717,718,719,720,721,722,723,724,725,726,727,728,729,730,731,732,733,734,735,736,737,738,739,740,741,742,743,744,745,746,747,748,749,750,751,752,753,754,755,756,757,758,759,760,761,762,763,764,765,766,767,768,769,770,771,772,773,774,775,776,777,778,779,780,781,782,783,784,785,786,787,788,789,790,791,792,793,794,795,796,797,798,799,800,801,802,803,804,805,806,807,808,809,810,811,812,813,814,815,816,817,818,819,820,821,822,823,824,825,826,827,828,829,830,831,832,833,834,835,836,837,838,839,840,841,842,843,844,845,846,847,848,849,850,851,852,853,854,855,856,857,858,859,860,861,862,863,864,865,866,867,868,869,870,871,872,873,874,875,876,877,878,879,880,881,882,883,884,885,886,887,888,889,890,891,892,893,894,895,896,897,898,899,900,901,902,903,904,905,906,907,908,909,910,911,912,913,914,915,916,917,918,919,920,921,922,923,924,925,926,927,928,929,930,931,932,933,934,935,936,937,938,939,940,941,942,943,944,945,946,947,948,949,950,951,952,953,954,955,956,957,958,959,960,961,962,963,964,965,966,967,968,969,970,971,972,973,974,975,976,977,978,979,980,981,982,983,984,985,986,987,988,989,990,991,992,993,994,995,996,997,998,999,1000,1001,1002,1003,1004,1005,1006,1007,1008,1009,1010,1011,1012,1013,1014,1015,1016,1017,1018,1019,1020,1021,1022,1023,1024,1025,1026,1027,1028,1029,1030,1031,1032,1033,1034,1035,1036,1037,1038,1039,1040,1041,1042,1043,1044,1045,1046,1047,1048,1049,1050,1051,1052,1053,1054,1055,1056,1057,1058,1059,1060,1061,1062,1063,1064,1065,1066,1067,1068,1069,1070,1071,1072,1073,1074,1075,1076,1077,1078,1079,1080,1081,1082,1083,1084,1085,1086,1087,1088,1089,1090,1091,1092,1093,1094,1095,1096,1097,1098,1099,1100,1101,1102,1103,1104,1105,1106,1107,1108,1109,1110,1111,1112,1113,1114,1115,1116,1117,1118,1119,1120,1121,1122,1123,1124,1125,1126,1127,1128,1129,1130,1131,1132,1133,1134,1135,1136,1137,1138,1139,1140,1141,1142,1143,1144,1145,1146,1147,1148,1149,1150,1151,1152,1153,1154,1155,1156,1157,1158,1159,1160,1161,1162,1163,1164,1165,1166,1167,1168,1169,1170,1171,1172,1173,1174,1175,1176,1177,1178,1179,1180,1181,1182,1183,1184,1185,1186,1187,1188,1189,1190,1191,1192,1193,1194,1195,1196,1197,1198,1199,1200,1201,1202,1203,1204,1205,1206,1207,1208,1209,1210,1211,1212,1213,1214,1215,1216,1217,1218,1219,1220,1221,1222,1223,1224,1225,1226,1227,1228,1229,1230,1231,1232,1233,1234,1235,1236,1237,1238,1239,1240,1241,1242,1243,1244,1245,1246,1247,1248,1249,1250,1251,1252,1253,1254,1255,1256,1257,1258,1259,1260,1261,1262,1263,1264,1265,1266,1267,1268,1269,1270,1271,1272,1273,1274,1275,1276,1277,1278,1279,1280,1281,1282,1283,1284,1285,1286,1287,1288,1289,1290,1291,1292,1293,1294,1295,1296,1297,1298,1299,1300,1301,1302,1303,1304,1305,1306,1307,1308,1309,1310,1311,1312,1313,1314,1315,1316,1317,1318,1319,1320,1321,1322,1323,1324,1325,1326,1327,1328,1329,1330,1331,1332,1333,1334,1335,1336,1337,1338,1339,1340,1341,1342,1343,1344,1345,1346,1347,1348,1349,1350,1351,1352,1353,1354,1355,1356,1357,1358,1359,1360,1361,1362,1363,1364,1365,1366,1367,1368,1369,1370,1371,1372,1373,1374,1375,1376,1377,1378,1379,1380,1381,1382,1383,1384,1385,1386,1387,1388,1389,1390,1391,1392,1393,1394,1395,1396,1397,1398,1399,1400,1401,1402,1403,1404,1405,1406,1407,1408,1409,1410,1411,1412,1413,1414,1415,1416,1417,1418,1419,1420,1421,1422,1423,1424,1425,1426,1427,1428,1429,1430,1431,1432,1433,1434,1435,1436,1437,1438,1439,1440,1441,1442,1443,1444,1445,1446,1447,1448,1449,1450,1451,1452,1453,1454,1455,1456,1457,1458,1459,1460,1461,1462,1463,1464,1465,1466,1467,1468,1469,1470,1471,1472,1473,1474,1475,1476,1477,1478,1479,1480,1481,1482,1483,1484,1485,1486,1487,1488,1489,1490,1491,1492,1493,1494,1495,1496,1497,1498,1499,1500,1501,1502,1503,1504,1505,1506,1507,1508,1509,1510,1511,1512,1513,1514,1515,1516,1517,1518,1519,1520,1521,1522,1523,1524,1525,1526,1527,1528,1529,1530,1531,1532,1533,1534,1535,1536,1537,1538,1539,1540,1541,1542) have mixed types. Specify dtype option on import or set low_memory=False.\n", " feature_table_raw = pd.read_csv('data/feature_table.tsv', sep = '\\t', )\n" ] }, { "data": { "text/html": [ "
\n", "\n", "\n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", " \n", "
# Constructed from biom file
#OTU ID10423.4T6YHGRF7KF2C10423.19X1DXDQX9QY910423.5EJZONDFDCFIN10423.15PCQYUJZDX1S10423.749Z5IK1KL20W10423.11WHV0MTK27VM10423.W7I8EQXO3BQ610423.21JY1FGU6UYER10423.3NNWO34AYC1JI10423.4EQEGELUCG05B10423.2Y880KZBO075410423.DI3LYBHX9JY510423.20F5SYYEOOBTP10423.5B7MCFODKXO4L10423.B50D150HCD6P10423.54ZN0NI5KGY9G10423.13E9T6Z5UIC4N10423.4Z32KV8UF4Z6F10423.22H331G9CQEUO10423.2SJFU0Q5WUQZP10423.75M0X555G8PD210423.3W4GS7E9M3GE710423.20JHP9VC6NLOS10423.13Q7F8TJQCL3910423.24A1VTY597UXE10423.1NS1SUJIHZ01K10423.5UE7SYPSA13S110423.3LQL388KPP3IH10423.BV9LDI0ZB7NI10423.6CTYXFB4DI3KM10423.YSLRXOXRAGDN10423.2PGXF1ETMAJIE10423.633W2VOM5U5EK10423.7EFLMQPXQFTYY10423.2JBOA2RMCI4J910423.5LRQ291V2NS0G10423.DV47FMBJP9PC10423.3BNPOL2M4OUJN10423.74QO5APGCBFT110423.2WA6K1VNZQK2E10423.4876SWOIRHREV10423.1VQ2AK1VJFF3E10423.5BTDZYFK4G8WQ10423.3KWL3PYI9T5VW10423.1BECDKQFVCT7810423.4CQCOQ73D4R8A10423.3BNGRFUC1F7I010423.5WQDQ61M5I5HR10423.2WG5NQV6HSO0W10423.59AVAKRTIFXU10423.45LUC8I8L0ZPR10423.6YS1WGGDN5ZRD10423.3H55Z46MPQUT410423.7CD1PMJJ9JP4C10423.E0MCLM6PEBNS10423.19UABCDTCF7Z110423.2HZ5JX6V4HF7110423.5N8B686ML457Q10423.3J4QS9LQCP1Q310423.20X10T3MTSTMH10423.6PVP8IEQXY43110423.3A5FW49PNPG7C10423.BSRFXQDHQBPX10423.1XT5THMNV7A7Q10423.7OAYL2KXUPF5110423.9M3NWEERYBYN10423.UYN0SJUR72BO10423.5GSJL8096GWEZ10423.32LESPIDRL30110423.38B3F85A90G3Y10423.JO2ML6MMONYZ10423.4E6JT6MFQG4LG10423.52GSPF3IVL2HX10423.36K7B942QIP3310423.768823AFDO53N10423.43BQ7A31Z1QVY10423.2HB3SCFECHDFQ10423.3E78EE3MAR8B910423.6YXS307M1YGO810423.2LJA9LF5GWHFH10423.2FY40MYZRQCP10423.3Z5TU33L343VD10423.33C5VCBYG37K410423.3GA24EZ7P38AQ10423.2T91JJXPRTBJN10423.PE0691T7DO4J10423.4XSUK3T0JVPRR10423.40KMOAOMJMA6R10423.5I4U9ZTN5E6SS10423.6JR5DVUTZIF7710423.5U2A6WVEE6UTF10423.3R5AB6CNPWKSQ10423.681PRKKLDZP2L10423.3O4F3L3WFF7EU10423.AG8PS5M9PMDP10423.4NK01RNJGTCUF10423.5O234CPBRWNVW10423.1WA077NS2JLY110423.57L7IPFT014WZ10423.2HLE707788SAX10423.19MIXT3IWJXE10423.5AUKV6WN4BQA610423.5S1YMBRGHFQRJ10423.3FCVKWB4AFWQH10423.1RCOCT8D0XCDA10423.7CI14QLXEJ8WA10423.18ZWCBEBREAIC10423.6OVC5SFQUV2NU10423.1YJOUQOVALZTE10423.2RORFXTPZSBD110423.4165EO7IZV7X910423.3XWB3NR1J7KK010423.4XGRACCUHW52A10423.6Y6J62XH6X20V10423.3G8WRBD6VJOAL10423.2WH2ZGPU28T2M10423.7PX1U7PKIUUAR10423.2VYBBO6V6UEBC10423.3MUVHEAG1CG0910423.5K9X8B8LY1FO710423.1RV67P24YVVZP10423.3E3K03915GKAB10423.5SU5QQD5R3IJU10423.5D5FRL0O03W8W10423.26BHBLZFQQNV310423.2SVSWOVIWA6U110423.6WQMGOF35N6TO10423.6RDI2G802KGFA10423.29YD3V7NO092R10423.H9ZP330TOX0Z10423.22C1WEG1JEEWA10423.61YQQNXOCOR2M10423.1LMYUJ4JPBR6510423.5CROEO103V9CS10423.4LCE2900CEZY710423.2IC65EHOQX4Y810423.5NGKDZ6FBNQ5E10423.H58BCRZXSS7G10423.4U8QQ71N1MVMJ10423.63HEINFZYT59110423.38R40FOBJKBW010423.5MQ0GYNB22SGI10423.3S58T1HLJKNFF10423.1376UB2AROJAC10423.3LALDS6G9BFTN10423.1KZEX8TN3UZI410423.WXBDZL7NVCA510423.77JCI00VOVNE310423.5OQKYOZJ23JK110423.53I33UX6J48YU10423.4GREFKC5QDM7A10423.NIPSAY33YK1110423.2ACCI5YOTCAXA10423.5JDO0IF63U95O10423.38BL9ILUFJQ7810423.7B30959IOXNMH10423.56SPUT4BXK0910423.3M3DNBS131EB910423.5PFJ684QKDI9U10423.2RJ9ARTUU39EL10423.2QPZ6XRPTU0TP10423.2W7XBRCALFB6G10423.2555QJ5K9VHFS10423.RE2TOXH0V54S10423.462BVZ0X7XXHV10423.2H3CEVW5SH2LC10423.RZS4CM6RRAS310423.6TLTXN3GMLID710423.79X6ICW7ELRAG10423.59KT7MBTH5JX610423.QXL9YESDY7CO10423.2CAUBVXCPP11O10423.3BFHCLJQ8BHP710423.PLJIBTOIAK0I10423.3JCJ1HLVQVKNP10423.2HGLXIF9I6FE610423.3JY1RV4S74IE710423.6D2WJQXAL86ID10423.43ZJ1PM8NS5LM10423.4GVR7MQ02J45L10423.6NRJLWUFPR09C10423.3UT3F5FJ7MB2410423.PJOVP7HNPXZS10423.25VGQEGEG6S3110423.16O4ZYWK5C7L410423.KM445JSIU1DE10423.5AN2EVLONL2HF10423.5R66D1XNZLM9210423.4UPWOI6P5QBEQ10423.MUO0Q6MBYI9Q10423.3WO5RPRW1Y07710423.15FIPHXRBPL8910423.44V2DU7R2CN2G10423.AU842WNF1O8810423.1QUT4Z34VSUKI10423.UIMFL0TGN6JM10423.1Q7A3G954IAZP10423.4DUM74S1ULVMU10423.2ZKIPCSPMXHIX10423.MITO3YQD8KLW10423.44F1SMOPRSRAE10423.7QG2F5GTHIW3O10423.4XIC429UF0VY510423.5T3RQTIL5OFEY10423.2QSHCDJDBEWRA10423.1ILLSNF88B3OZ10423.3XYT93IP0SGHL10423.6SVQDTFCL3NPZ10423.60GXWQ4F82EQD10423.2ZD6TBNKGU1MZ10423.3LQ44P8XDC1IF10423.51CQCMT0T14YK10423.76VTGH6VXL3TA10423.16HWZ4ORK0GKZ10423.UG4A595Z2AM110423.4XZA0ZNJA0WRX10423.5FO15O70LQ4YS10423.1WA94CW25T8ZO10423.4FXOUAVXC7INY10423.1SBGLTAD6VMWM10423.4OO9K68HYAH8Z10423.2O7DSULD87S3T10423.5DO6JM2Q1C2WY10423.3MBLZBAWZER5P10423.2PP5R0XPINWCU10423.2G089KX84JI6X10423.76LQHV1T6N4Y410423.62LCGGX0JJ5LP10423.4MDFJJLDWOJDH10423.8AWUBIDDSQGN10423.1U0ZXG5Y1C20110423.6E76XWZ5WVJ0510423.1O8BB7ATVSIV910423.2N6BFSJ2TS0LB10423.2JR7WRB0AOYB910423.4QLM0SL513ND810423.3I1VK3V2S14DB10423.2THZ5VJVZJEHE10423.4OGA5BXW56RG610423.3XS78QLHABPNC10423.1V5YQ6U6U5WHW10423.7BEHI08WCOTJF10423.3MCCQQZR97OAM10423.52RS3ZMCCSYBL10423.4YR5UKVDDGYB110423.40754AE5KTIFI10423.4B6JJN2QXGT1Q10423.6BAU6WT5F0NE510423.1JF3XV8QHNR8A10423.4VGOMWH6OEO2110423.64X3STES5L8IX10423.6RT0TDAH6L24210423.3L7TFFPLUAOR710423.7I80FXEXNKP8A10423.68WBRZBG841HP10423.33D3726M0JCLU10423.45GK8G9QOFCPQ10423.7A3LZ8QQ4QYAM10423.5C0AFD9Q6YHWY10423.7E0ID91K0C38M10423.3VTQAS3Q857M610423.1ZDVEJ4R155CS10423.1MPWGD0SCXRQH10423.15ZDCPX5XPGS410423.4EU2UPGFHQO6910423.7CFJV2B6R4L1X10423.7EQCZXHDYKAU710423.2RX9KU1STLJCC10423.1736SCZDWZR9U10423.4URIDZKLX1ADT10423.6K3QHXRK819ZY10423.2RKWI5WFU63I010423.56C5QT2WSHNLO10423.61NZDH684KA7D10423.KP43VS06Y7E910423.4WBANB81IJ0H510423.4HUAJHJQ57RNA10423.7FIB76UT4YFKV10423.ARHX9DMODDC810423.3C3HCNDDBZ3A210423.VTZSMZJV4BVP10423.39NE3ZYO7XQHR10423.FYEVZHKAEBOV10423.397EEJWJRK2SX10423.4F6WVWLFTJ60N10423.5JZ5V4H5PWYSY10423.1ZXIT3XP7UKN10423.2E70JN724SF2K10423.75R180OGFEH8810423.6MMBW0XWTNIPU10423.2APMWJYPD7VTC10423.56EEZ3MA6SWHM10423.1LY768VN9TA1G10423.NLFZ4H3UMUX110423.5X6O4A9UDHWEO10423.7BGZNG0JU9PH010423.52WSEV5NBYQ6R10423.33XOLPUUWC5AM10423.60597TIBFHSTE10423.3GU6KJNT8IYZG10423.6HZBY6YYWKJ4M10423.74CZ58S98P81R10423.44WGO321Z5U4810423.5FK67W9QG3X3R10423.6FSCVC950KT4510423.6TL41YVJ6YTBI10423.47P50SDHBQ1PA10423.6RLRA77ST41CY10423.6E27ZMAHIUFO10423.4QBBM4TC5C8I110423.6AV2IUIE7QENQ10423.4GMN1U14UHHDR10423.3T3CNGX88CFYO10423.3HWMC33HPLPGI10423.7GBLB0WY57O5R10423.5KIUUMUS5RILY10423.7D5TZ65439NLY10423.4PJ7R5U4SSS0I10423.6GU48B2G0H1L410423.3PLI1UP84EUPE10423.5T3HXWTE88KA310423.7IZFX4UVT9BSG10423.3VWBBU19TGO810423.1V7AMRIWO10C410423.1SWHHWCPGLAJU10423.15R50QEA1C3XO10423.6LVTQJCM8F17E10423.58XA63HTPV0CD10423.3ZG48QVDYVIQK10423.70PMEGKDZ2KU110423.4YU4YJMO7EW8O10423.2ZHAO8T4PPWJN10423.6SK2KOA5MP9W810423.1VGZ0ITX5K0ES10423.5JG65Y6TLF53910423.5VJUZGXA9PS7910423.G375H9I0GOLM10423.5DYYSKB33MRVF10423.6UKM6N5GSJSWJ10423.63P5W3Z8ITG3F10423.2A4D3BO308L4H10423.7OLPY9CE2TW0A10423.3J7ZP52842USL10423.3A733ICANSAAR10423.1FFN1K3SBVB7V10423.5B5C8DO3CG75F10423.5XBOF5T5CNO9U10423.4HL6DOUUX64VG10423.50BOVC7N8RLJA10423.7F0NEL96UBPPE10423.2GAB872AVHH2310423.43M0LXUUUT5R510423.1BHKEOQ0SKE6I10423.665Z0FLV2HHXF10423.2P0WTTVSBQNQC10423.487EUAFW0L6DA10423.7HU05V6ZO2FAJ10423.6JI8NBPKLYKCO10423.2KYWWBI9U73P410423.5T8J4JTM1KK8H10423.4U8GXACG470HO10423.5HTLYA2JKWNXH10423.7G26Q6B4L4J7Y10423.3O6X90VJX03CF10423.64DOM7QCN6JUS10423.21091X37R0ELR10423.68U2JOS2TSSLR10423.4W8KGHP0RUPL510423.49EGB1HOX31UA10423.4GLGSYY76RPAE10423.3H4XXQF9GNFUP10423.1C4ODKR0HFUZ10423.262D5TAKIP13910423.3YN26AKM7PP4310423.6HL53UL7MF1A210423.5MYILUVDVW0FT10423.I3QRG4T6B7LX10423.6M422IVI4SE1U10423.2LLJHVYIV7QBF10423.4QW4GU4B5YH6U10423.3GUFHOW3BSM1310423.2SQISWN0ZOJU010423.7QR1TPZMYQRXC10423.1CP1CV5X2Z4LY10423.1F9GHTHJOZR9C10423.7PUSLX674JLET10423.J521NFDO0M6210423.7H2D9F7FNW0T210423.FM2P2T4553XR10423.2S50YAL1DLU6Q10423.71E48SUL99GI610423.5P0MG7J1ULBDL10423.7IW9D4GUUHXUS10423.2I9WX3YBCLW2A10423.6M6C6KVSD9V1010423.2OYEOE44U5RSR10423.39NEZRFL23YKZ10423.2AUV8T9DLH2MX10423.1JEE270T2126L10423.5S4POWRE2A9QR10423.2BYFRB3BHHQ3010423.5ZH0AMGE8KK6W10423.14QKHYSJTFMIG10423.18N8ULC0FXCI110423.5RNM49RX14X6410423.4UAR1CCQCOHGU10423.3QMJJ5ALOOE4O10423.4VYYGEJLD9SQ110423.1J3VM5HMX68CZ10423.45V8X342544NK10423.XQUEYVMRE7WO10423.59GISF0FXMH3P10423.4LF54TZXX9IXF10423.7GANZB2AKRJ4110423.5SGEDTDHUUVNQ10423.2M1T08PU9195410423.1B6T1HYKKFXB910423.1LBYK74TDXN9910423.DW3092J2LLSO10423.4OZ9UI889OL5V10423.O4W1HMG77ROE10423.1TLWNYHKB8B9P10423.38LVO6DNBB52F10423.3M8VSHRW8QG9P10423.484ONGWV9WVHA10423.2X8YT1XO5OULQ10423.9NGG8K1FZNW310423.24YBOSGZABBN410423.53NTAEOEXWPVP10423.286ISEUVQW4WY10423.4N3QJEW82ZU0Q10423.5ZAEA9J6I3TCN10423.1EY863QG4I8E110423.XBBO1T5NDM7W10423.6SNH62FJUK2SB10423.6VO5TDIHUE89E10423.4LRTRQS27WD110423.T0EZZADSA7C510423.25Z6LSWJJXN5L10423.6WKOU314M19WS10423.5I7CFFLAMZ2QD10423.B20DAWST875U10423.1Y8FN9GUVY8UV10423.6Q68KBETWZ5ZV10423.7REUO5ITNH6N010423.UPHD36BADKFI10423.3UZVDGAJJJPQ10423.33K71PKDXJDJD10423.T9BQJFN5U26O10423.39W2T6CKCE6DV10423.7A4A659WSU3010423.GTZ3VJZJ518X10423.3PD7YC8IJP1OI10423.5KNFO2ZZR0FIO10423.17DY5JQU5485310423.276EMU45R2QJE10423.4ZCWMC5N2TAZY10423.1NC17N0H7F49I10423.2COCRNOQIO0W510423.795WPO55PE4JV10423.ZRE0XQXX8QWZ10423.6LR81BQHSZW7G10423.FXXXGHWY19OT10423.4M8SAQFEKYD310423.5WGSLUD3L3GPV10423.6WJQ19KX34XTG10423.4A7IDHSGO8VGR10423.1K7X36B85JXT410423.5VML6AGB0E33910423.5NB28T6K5YO6Y10423.7MAVXMPA17Y4S10423.70LRGON3TGCZ010423.6RQJJOZQJ6E9P10423.3DNKAN6WP2WLH10423.5XMNTQBYTVK3I10423.2EYXV53KH0BQ010423.Q4AACVQJIQOK10423.5ITJKDQKKEIGY10423.4U05R9NYL97H10423.3WZ621RMDC44310423.5NMYZ3K17MP2C10423.16A5LO5J005QL10423.7HMYO2VOJOTHU10423.55ZBPLXWGP5RA10423.2OJ1LZQK6M5XK10423.383KYWUBS9SB710423.5LTZAJL8GZ0WE10423.5HOTOSALUUB0Q10423.13R2DAIM7UMXF10423.5G9JW1PX1Z2PA10423.F24SF77M0X3410423.7V5697M6IHQ810423.1KQWSCLKA1RIT10423.P2IXE2FJMI7L10423.21FIVOXERRD8W10423.746R4EKGNDH1M10423.2EXIP4SCQ0WL010423.4Q18NIO9EE9MV10423.58X18Y9JMLDAQ10423.7R4T6MZAUZETG10423.31943XOZSNSM810423.3KBS90NJ96X7310423.4SCBLAJNJ9UK010423.4W5SI586CTYIP10423.4MIYKH25WJTF510423.4GAQBJNNSTGID10423.1W2L16NJLMPM10423.2VYK8TF5A41CZ10423.6Z01BAQZG9PK610423.5XZGDTVF77UWA10423.5615GH36H3JOS10423.7GDF1W285M23910423.41MEX0YUDOQQY10423.27UOFSMZS679410423.54933MZ1AW0KK10423.2YTIPKQUV5PX710423.2TC1JA5XFXHKI10423.21STA2XFBMY4Y10423.61ZLOPMQU6SWS10423.26OZRDQTJPNPK10423.18RN4KEJ0UPKO10423.2S0O68771GC8F10423.C11JG732G4QT10423.72V772FWY93SQ10423.5RWYBG85I9YWD10423.6XUNXP8OE0W9T10423.45Z3UV1CAQCIL10423.6U5A008SZ6F4K10423.6OJWE11X5K3SI10423.59IB26K5ZKNZL10423.7LZVNAPJPTU7W10423.7R8HKXTW0A2UE10423.5XMOPHSVO1S6Q10423.4ILJGETV096AN10423.79EEUKD8J7CJ610423.L2MJNJDZX78Q10423.4MYZ5OL773P7710423.78SO2T2YTUZU910423.1XI4NE60PMY7M10423.79GO2UWLXILF410423.6W6OK0T6MIZZ110423.6WTDJ9F0QHPSW10423.4S2X0FXTZ6PM710423.3C5ZI350TJZ7N10423.36P7M4NDPOGY910423.2TSB1MX8TR0E710423.4C7C3SFUEGPFD10423.63KDMM7ASR36O10423.5RE7JF63H1S8B10423.4KMAIFBWAX5AZ10423.CBJ3Q9CD4QH710423.RYUSMRJ7B5QD10423.2526MKE9FXJI510423.GJ7QOSJB0KDO10423.2CQUX3GE08WTQ10423.W5FKEDDKFAR110423.6VZLL4WBJP74Q10423.6CBP3X8POMYWM10423.R18SHSGP2NAE10423.166ANW88UDXVK10423.23YD6XC1GN90F10423.V38Q05Z6M7BM10423.3DA9W96W57BPF10423.6AR57EFIZ63L510423.54K3DYYRMA4HG10423.2ML1MK8GGSPWG10423.4FBX6S4QSOXVT10423.1BX35LSHWKZVA10423.4IYC0IDBDLH3F10423.5BALGEFOEVM2810423.7NC6C2IXOR4LP10423.4GD7L7YEG84CQ10423.4R1DOUVW8DW3N10423.1J9CVK0L8P28710423.1FDL918RV8XH10423.3XO1VWR8SNZMC10423.3NM2X7Z0XXNM010423.22VHYRLDVZBNN10423.2CN7EK2PP4GW010423.67PS5IQ7I5G3Z10423.1U99575QRVMXP10423.1LDLRL7EE0HCO10423.46KDO3BYNPN7G10423.M1DWW4HBP9OU10423.726OGYOSTW01D10423.57QHMHOAWMRX010423.26FMOFTO8EDW310423.77L8YWPL1Q2710423.NIGV5PT0OWZE10423.VAZ7P8AWGA2S10423.2PZP2TXSHOY9O10423.N7YF46MVU35S10423.6J2P0N66NRQKO10423.16TTPF28LOHGD10423.2WLFRJ3OEEB0X10423.6UP5IZP4FCIRN10423.5CXOE4HFG3LEI10423.1D21YCGQPEUD510423.27IZQW0VZLLC510423.99P3BKDJR0ZZ10423.1SGG0XCRBV6OK10423.3BHQKW33MMQL510423.6WRYD93SZIANW10423.28HJ2QUM2A8TU10423.4XT3H91AN5CTE10423.4PV23S20RIPOC10423.605A3KZ89O0WM10423.4PO9GCQGLZCE10423.5UISMEUZVA0OR10423.5ZD5CUJ42YCBV10423.3YV3CNT1P5V3C10423.4QWCI7VOF1W5910423.3I8QHM0KLRI9710423.460R293XAT6M010423.2KI7WJCV2GPWZ10423.7OLQU0TAX043I10423.6JVI5Y8OBNX5I10423.4GVQBV938CW2D10423.3S7QYH9915JD010423.7C4LBGD7UFXB10423.2E1ZD06UBGF4610423.6BPGHVHVSRC4F10423.79WGMOO9YZ28R10423.7PXSLNEESNRFO10423.JYK6V8VXD9PD10423.369FY2CMIE87U10423.1TV0TR6FJ9Y1J10423.71TVWV5CGJP8L10423.3V9LUNF4OPGXG10423.2L98S2VMOEPLX10423.5UFSMOMS75UNW10423.6BN6DTHLK9V5910423.5RQ49PJKIPT3P10423.573D6MRHP2V7F10423.7R6THSAE610NR10423.32DMJHI8DEK2F10423.2GC3HYM0XFNXZ10423.6I4U3CYU29L3210423.63EMKAZ5JSE6L10423.3KM2NOFC4YC2A10423.7N2U4W2P7M2VG10423.4Y3D05C6OQJLD10423.7O88E91X4149110423.2795PF43BX9IM10423.7IA0R2Q0YMB2L10423.15Y1G58G3UCXW10423.3UNU74NY56W5B10423.13PA3IYW5WG1J10423.6TTW1X1OT36310423.O47MX02Q19OB10423.6ISD4VSTTK4NV10423.4NHHWBVVZ8GWU10423.3KF7Q69UB7Y6E10423.VZ03IIUUA3QV10423.1GG101JP94KQA10423.3X8R6DG4XQSVZ10423.QMT106FBNIE710423.4R11SID4NB9U10423.7H68774PTI8O310423.31PLNO7OFKQEC10423.3DDPDET778COQ10423.68GK3X0P0TSRA10423.2HPJJU1FPWIBX10423.2QKPYX04RELWW10423.7B0I3PHV7CROW10423.6G4IIRUW5IH1610423.692R8V5YY98HV10423.5WL5DWQXX8YO610423.1GX6YCORD80IH10423.6GJCV4AZSCKPV10423.T8NBYT9ONK6L10423.63ENG2G2DYM9T10423.3L7UB76IOGWUF10423.750A5DUVQWCO510423.2P6N0DN0QJ4N710423.4L44UI07LVF0J10423.28UBMUE2FMJMM10423.2DIHTJFY0FBB710423.498Q4HQGIAKXF10423.28C0XKUQWL6VE10423.339OLO17SOJPR10423.6TUIMTHCR1Y9B10423.122GYPMC24BU410423.5JK2LMSRZT82M10423.4V6EMCLMB1AU10423.ZW6AFIVNB3TQ10423.102EB9QO8MUTV10423.1CGCNOS0YIOPU10423.108KV0CWVIESE10423.3XWK0SZBMH7LN10423.GPFRJ0BWCBDT10423.3NXC4P71CLEKJ10423.Z5W6BOYB619P10423.1N7XCPUWYJ9CU10423.1LCOFVCQTKCAY10423.79DOYW5B3KNHH10423.5O7LB6GJAMU310423.4T4FG9IUVTB1J10423.61K2213CVZZ4S10423.6XRWV48QT6DAL10423.OINEEM43GEKI10423.2T7PMZ8ZXY7PF10423.5YHD3KPBL47TE10423.7N53D6M2LXBRE10423.1A7SR4575E7TI10423.OF7X8ZT1FDL710423.5G9J0A907SUM210423.22A85JARJ00YS10423.7J41MCH08OGSE10423.1HUBZYO6J3GYE10423.53IK2DWTVHAYW10423.48SONIQIDKH2510423.56RGGCE0NEUC110423.7DK2AM4FBVCI410423.7HI4XHI6V69JH10423.2CQ6IIU0J2ETN10423.6P0LDT7BXAHKN10423.3JDHUB239RWR110423.22M3DWZKBW6PU10423.1DS5I64UQWP0D10423.7F158VPR0UZSO10423.7AR50RKPW1HVF10423.5HS95XWWWVC0110423.4EOTMOOUFB99G10423.4OYS07RO35B2L10423.67CALIFQJCOCQ10423.3NA66XLJW9MQM10423.4QCHUZW9T20LE10423.4B772G87KH2YL10423.5FJ8W6F2VNS2110423.5D35NJ0DRMF9Q10423.24D1VK6CXC0Y910423.3EBBDJS9PGV4P10423.5NTT0U8M76UV010423.2STISMV8NSPUV10423.4ZY7BBX69YTS110423.6H7MO2TTTG1FL10423.4N18DZ4KLEY3510423.682KPM9NVHQWR10423.6M5UCAF86QKXQ10423.3SQIM9S7WJY4A10423.5F15MYIHHFVAU10423.6XC571XZLW4K610423.4R9YXQN7WYBH10423.3R17C0O0B6XZA10423.1P4BLUVZMQ2C510423.H28BMJS9OM6L10423.6RR0I7ZDVJG9R10423.7IQS3PXWIZ3ZK10423.1G50PPJYXQGTE10423.7RC3LKIW2MNNS10423.333XJCT2JPUPO10423.36GIWY9HL812510423.6GBDGA0DZ8UX210423.38GUHJDFHZ54110423.6GVAH65DO6TOH10423.O9PS2ZXVQBMR10423.6WTVS59CX96Y10423.5Z1PL35ADNDGJ10423.4B0RLKDOUBVYF10423.4SHKTBB8LP9GT10423.3V2GI3COIXKVL10423.1FBYN9976KN6X10423.2360ET4K0U5H910423.6547NGSK2L9GG10423.DLCIR0XSSDA10423.5X6W5O17MLBD310423.48RCQY1SJPD7X10423.707BP712G182T10423.24IB3KXXZRFV210423.6WALVGW1V3B1M10423.5RDXQIGWJLX3G10423.5K771HPL7D4S710423.1WODL148D0NMO10423.3GXU331HJNEX610423.6SUK4YCEXDVMM10423.5CK5YCQ1N4LK110423.WCIJAA8N93LC10423.1LK6W6NPAB03P10423.69SUSOU2ZR35310423.38C0QXZXTGL5O10423.343FO1305AUAP10423.7MLF9FPD0901M10423.7I58HKY38JY5U10423.3XJ9MEZB2LMPL10423.5N3JSHVLP80E710423.4TUQG4TP24LOS10423.2QQ78BJ32XFS410423.7HVNMOIGT4XE10423.1IRBZ76GN3KLU10423.3YI1VF1B8JX8X10423.7K4U6HU3POD6110423.1NHAFNS29UJ6B10423.EI181ZIWREHM10423.618TQBC9BIG9H10423.44O7GC298M96K10423.2RBYVUA9MG0K910423.2K84XX7SBIR1T10423.KL08YMFY2CHL10423.6YF9CCWX9TOYL10423.5W7MY4ZK49YTP10423.1GZ9MD2BGW1HM10423.3ZQMOSEK3QCK610423.6J8VKDSFANAJ710423.6ALNXZWKNN9PX10423.7H3P5ZW5HR4NA10423.4R5A4JHUMRZ3010423.2HZDLAY8DKU5G10423.5G7IP4XWWR8RR10423.3O83HVYHKPVFS10423.2LJ1CG6VDMUDU10423.2B84RFSHB6FFR10423.77FIFZKIDFNMA10423.5FTJAU6VRF6X810423.411BO2U1BCNYW10423.3XO9XAIM1REKR10423.78MX0HUTKWAU610423.1Y1E5H5JRKN2610423.3GF2FAIIO905W10423.60IRNL9P8GSNV10423.2A43AEYW2SPZM10423.337TZ1F0Y3XP110423.5LW9ELLIPGHVK10423.1JG19L3E23WA010423.2XUPKT7XV17AN10423.1FMQW7HK8VC5E10423.7LYJQQ0TVYQDO10423.2G7K5M2DAMY2V10423.6WZQMH3YDOTLI10423.626I44GWWP1X010423.1T27OG3XVDRGP10423.7BGQQAS9R02FD10423.4W3B8GXFPFAOC10423.2DTQ5971KWU6I10423.3EEC91HE7R98S10423.RB2TYP9CQZ3X10423.2EI8VCY5P9XXV10423.6NFDYH8OKTCCB10423.61I8B5Y2VLL7A10423.BT0D2YNKZYRK10423.2C1EV9UMBFO0N10423.6UUWLAX9OB7RQ10423.6ZB1LMQPRNTH210423.4Z3KF5PELO99P10423.212R7CUV8LAJC10423.7671T87HPYD0A10423.5EEPKV4XGQSIM10423.47KK7C89QH4SK10423.5JDN4QY99O12G10423.2G65EEC8V5B410423.1ZYGT6SZWXY1K10423.2FITE4JVX6FD310423.2V653122RCUM910423.TB6D61U0EO7E10423.2CP7PPDT062QB10423.1QDN6NY2RPESB10423.3CRJ484U3Z51D10423.15BDCO3IU1V7910423.56ROHQ5DWI9AG10423.2YAZ35Z98UQ4C10423.BCITCFYY30ZG10423.4JBTKINSCE8UO10423.QX3FNY87EX9E10423.5BNMXN7EVHJWN10423.38040NMGRSKAA10423.5BB3AOW8LEW5I10423.1KQOQYU70YCKE10423.7RXMBY1SIVLEA10423.14VKSUBUSLEDM10423.I3ZOLD39KUNK10423.5H7UARBD1E35C10423.6YYYBVAJPO8RL10423.DIKKHB59MLY710423.72RIDJ7WJ63U10423.72TCKFTQ3OHS010423.6LY2YTVZMQA3C10423.1PIBVX3XM8C9W10423.498Y5VHTRDZVU10423.6KGJ21B0LDKSQ10423.3EZA5X98ZNXO10423.7MNOHQ8QEK8XK10423.4AFQPHBCKM8B710423.4RXMWNPC2L2M610423.PBXI8O93PN5E10423.4QR3A743CMH8G10423.7CCRWPUCC3TZH10423.46LCGWS66LZAS10423.64T7D4STR75JK10423.2YFIFIIWVNFZG10423.3OBYFNVRQC3AT10423.237U5O9U18JER10423.1LPG47FACQF0I10423.54Q10KCQ5W1EC10423.404MYUMI38MHX10423.7J911GJEDO0KC10423.184Y5BSOWVZQT10423.58FX8VPC0E3O10423.2YJNSCD5DB60G10423.6TFTY6N1AD6BH10423.4K99WY12OHFJS10423.58E9L5QKR6YJG10423.69MVOZUKHOZ6L10423.27S6ACVCALBBJ10423.3AI3DUC0Z6E7N10423.6HPOG74V97R5610423.O1HG3H1ZCYSB10423.5W2MN9G9546YJ10423.47UE8T52E5GM310423.4CVTY4Q1ONL3I10423.1K8E1PAVHWZT610423.3737W6VBP6QW010423.28YPWTGL0JWP910423.7NUH1C297SHCX10423.7P9ISOVKRKAPY10423.4TIV7R4W98FXQ10423.TUUVICBMB6Z10423.29TKUDFPXXW6010423.4P87GTUEHEO3M10423.7LRW8GEXWQ4F310423.4QTLFMVQU7D6110423.3QHICIADVCE6A10423.773BWSHUEBRM110423.4H1HE6H8HBL2G10423.1FBQLVHTXH88I10423.6N4UMO8LLSAFH10423.1S87OXTVFHTU410423.3E631AHLH7OB410423.20ORT23U398OT10423.L2UL1AR90M7510423.2YC5C126WKI7P10423.5276PBY3H05MT10423.3UYLKBFEDBD0K10423.7CSSHXDDMNPRJ10423.1ITL7HPU1ETHS10423.31F37MOIAPWKQ10423.2Z4A2RIB3A6SG10423.429H00T6SM8BP10423.JFKHOYJSVFZO10423.29OKJHWEYS4AU10423.T3TLDFS0508810423.2CUPUVDO5V4OR10423.391W9DWOLV0UH10423.2TYHLDJHGMKCQ10423.K0UAX965UQOJ10423.7DRSPIY7XA0Q10423.7E9VG6YPBND2310423.3P1DLQ0MKZ40O10423.7OMW74FBQJO3N10423.5J5ESRFDDAO8010423.7P99VJNAOANOB10423.2Z6ADWTEEBSMR10423.19T6G5GGRNJ3810423.4YRVQ93AT3NCQ10423.5KEPHT0JO3SKY10423.269H0GOCFP20S10423.2KEZVFDA594XP10423.3VD7VA44R21QU10423.F4NTMFRXS13X10423.1ZJ4MJWC3KK9L10423.55NN0PBSO4JUB10423.1QWDYP04SXLGD10423.6FB8EXSR598GA10423.27AHLZST5SDCU10423.ACVMAOWAMOLY10423.3LMI42JXAZGP110423.3SXLL5P2ZDQYL10423.4U5ZNM1PGSCNB10423.61MU0DK7B0Q7810423.6J3DF7SK4Y8KR10423.68QTMTBL2EZJ910423.5QFW8Y3QNGJP110423.28AG3UXQZGFZJ10423.73BOQSYLL61KU10423.5JXL1EK5SS7X310423.28AP10612Q31610423.3HDF6V6FGAFQS10423.2KWEQVQMCM7RJ10423.19SXJ086ODW1L10423.7ADVI51M6C52L10423.11GGE1MVFC40C10423.7HOYZ86RUQFC510423.2U23M08HIZ56410423.14KTFNKEKGXID10423.710LT137GAGNP10423.7BUR0D07QICD410423.13COZH25XDL8S10423.5GCJVRY4Q38Q510423.3IXWQIX5D4VXF10423.6Y1IV7E67RA5P10423.3MRVHO28D89ZE10423.6RAA1C8F5CVG010423.24P55BMIZBLNQ10423.5QKOIFVODIWLS10423.2D6ML5R57J5K510423.3599ETGBFMQMQ10423.1EA7AAFW6OEPY10423.5NZKYWXOABRYB10423.4PXU24IV6JGQS10423.5T6HXN1LWCQAY10423.683YZV3YSAXYJ10423.ZOMYCR0CE7XR10423.1UBRAMXE9GIVA10423.J821DNLC4S6X10423.5JQXJ4Y9TJLYI10423.4G0RGIMT97CY10423.MHNF8VSPISIJ10423.4XXMTLKY9Y2OI10423.5CSEAC8XJHYEH10423.2ZBSJ2T9K0UL710423.70V3NV3CALEP910423.6NDCRKGOFLIES10423.10SPB51IEY5H410423.6KX9IX1ZBK5MH10423.3GFK9KZ2USA9610423.1RCNH1RG6R4A210423.1NCI6604JS69K10423.2GQRATZFJY7SL10423.6GRM2VASIW5NJ10423.5OA2J6ZXL0DOP10423.20EIA5SY1O1WU10423.2JUFXVAL7WJAJ10423.1P9LPN4HJBPC610423.66VS60G529IHE10423.5PTWK1L6UUJYH10423.4WOC4JZRZ4YBK10423.5MSRJJN8MXBFQ10423.2QFFV4RMUSYWV10423.3QH9FD23S2R4N10423.5APKKBDC55YF010423.72PO64Z4YDTR210423.300B96KDODYCK10423.31K3II7T9VOFW10423.2Z6JB21OHLFOE10423.6FCT8NPR2DZC510423.5MT0GOVIQ6YHD10423.4WXZMJTVMHQB010423.5PZMQLCF9N0VC10423.1UM9QOGKEBCOW10423.7EBRKQ9KEZU7510423.640N4YYM6KM0D10423.3D1SN4FQ5KBTC10423.1SS4PTYV4FSLJ10423.5FIJ0I75G130C10423.5G49S9HF5DFP910423.30DKRT3HE3B5E10423.5Y6CT8PL9Q3WI10423.6V7WB0R6GKPFP10423.1I5T8TNK6UMVC10423.1FHHO6PZ6FX8L10423.6YBSE3P29CGXO10423.97FV1105FS4110423.6I3NUHVWEJSZP10423.3J0NT3X2XZEWN10423.3HXZ4F94DN1DY10423.6HFE1JD2DGC9Z10423.7OS31IOJBDXM10423.320DWMG1HVFCT10423.2KXRJ7W90NJOZ10423.3SK35DXP6ER4410423.4GAPFS6QYN8F510423.5TE19PTH79M6X10423.3SUUIKP5EJ7ZD10423.6BV7K6Q11Q14I10423.4NIECA9MPIDVC10423.4KW5FNPLSRP7Q10423.S9N1KZW9LUOU10423.5QYNW6E455TB10423.2A2RDUA68XM5E10423.750R3WUJ39EO710423.42DDFPF570BB210423.KRUAPB0XMIA910423.4WGJVBZMKYFDY10423.V1E3DJSC1LAW10423.M6W224CHEBNA10423.1OJJMX1XGA1QK10423.3Y6KMK1XKSRBZ10423.Q2PGMYQMDZSP10423.2P661UNDE62N510423.4ODRZW68NLVIL10423.53FKYF5J1JD1910423.1SNDC3NU8JNS010423.2N6ZUD5GAYILE10423.3ZMC9L36K79QP10423.WLG5LWEUZ6J310423.1HSZ7MIJV250Y10423.4RXEV9XYTHNNR10423.7G9Y3MUD54U2C10423.2729A09X9F0IE10423.7INS3ZPOUUXYP10423.240W84KLSED1810423.12N8XNGE8KCFP10423.F8K9B1QC643A10423.3N55W228X3UVG10423.66YR9Z7FW7GF110423.4EYWLATX6984M10423.1A2INBWP8SKTH10423.9LLTLXULF1VD10423.5U8PNSPX4C1TL10423.WQ9W79WJHQHG10423.2BO68ESFFWJB110423.5OY4ARRED0FG010423.6SUC3KL1OAGO710423.BDX3LA9UW81810423.74ANK36F1RK0Z10423.7H0Q214UNT6PN10423.L40TWDOWQEAI10423.BN19DZ52XUT210423.1W0KQLL1OA8X010423.3AOXFL0LYQK0B10423.1U395QPBFNAVZ10423.4IASYZJBMAXIM10423.76FBWQO7AO61610423.3F4MD5BBJWBST10423.5KCG9IH69SJP010423.2RU9L3TL5HDBH10423.45JL3XYV6PQTT10423.586I7P7C76NP210423.2841IQK53HH2L10423.4YOERZVFSMFBT10423.6EE0ZNNQWFOST10423.37CT0IJU9LFNW10423.8OFA39R6RQB410423.XN8EC6MP1N3A10423.3SW0RFS32902Q10423.5H0BUG0EKNFCL10423.6973562WG8ICY10423.36TBH1SXYKBUX10423.56MP2M2ZRIPII10423.47RO1ZM1NH5Q310423.31V3SU7JL9SCS10423.6XDQ0RUZJ0VG110423.1RDTPWUDUGWDF10423.Y43XLEQH3KPI10423.18OW1ZELG06LG10423.1PVCHEER8O21310423.32HAXSCTIP83D10423.4I810N2H7A6G610423.4K64ACVAWXDY10423.2E7WZLKSV2C1210423.4S0EV066HLTOM10423.5ERR23WNXCQD110423.1NJ6K72XD70BD10423.6TZRUU8XTHD6410423.4WCGW6AZ68SKI10423.66159U8DDYXZ210423.6NPWEIRUPO65X10423.50MH4AG0B2AHR10423.IWSTWFKXH18E10423.2RUQJMT8HUFBJ10423.1EBLKJA73HLRQ10423.72NEXUFRK2KV410423.6EBRRD4DI4FWV10423.6FV3XX92LFC3D10423.2NOD7WU49JQAW10423.1PO9IIHW5U96S10423.4EG4XIAYAUTDC10423.38HIW3ZSZ5N4410423.6PYH6UVLCYV5H10423.7GNXHXLEAGVWV10423.6EGS28NOHA7S110423.2EEZYHHNXW4VD10423.5D06JK92XOHC310423.2UGREVLW5HP0Q10423.10WCTOF6Q2LEU10423.4R9369QDQQ8910423.5P3CN122L9M9L10423.3FTSM27WB9PH110423.5TZ27SDSHIW10423.18572H0Z05MSG10423.56HNVZ2RY6PK410423.3V0O8BSYGZDZP10423.4LPWI0RE5DZSO10423.359ZAHO8V9FOF10423.4XSMIQ1NASATC10423.21YKCE5KKLN5110423.5G573ZC2PTKQZ10423.50A41MANBMUNF10423.T062U23P0KAI10423.7LS49U6B5TJDI10423.6ATFBGFT7NKKB10423.6J5762XU5CMI910423.4U750PNQABWNG10423.4MX4J1Z0CJ36H10423.62NULWOO141JA10423.4TPP9HTH8SLQE10423.2BQODUK2XHF8M10423.5N5K3N6P09M8I10423.6BDL9HT2ZV6DD10423.7AVYRCY7KK1TS10423.6ZFTV4INHQ6DT10423.62TW9V6X1BKD10423.46A39FK5RY8C910423.3C8IJADL5B38G10423.6AYOJH7EA2ZH410423.2GMUV5DH5K4T810423.7QDBCKGVWOD4G10423.2AP529I56OLQ210423.592JE49ESAF9610423.7O2Q9321YC2AL10423.2SQJOO3XTURX810423.5NR2U0PLGIJZ010423.22UTK6Z0ESTNK10423.1ZIP54I8PNPB510423.3TQEQGRKN9XJF10423.A3P2TUFZMYMK10423.EL17S7QKVKIH10423.3QXIXPTF5W9YC10423.EM52Z535N9EA10423.78CEKGBNG1H0K10423.3WK9C15XNJX7U10423.5BPA519ZVKE0210423.7JAG7GUM4NFPC10423.5WVVVC1HB77G710423.7CLYG6OSN3JYV10423.1E2NY7O0VRITZ10423.4SGFG7P7S5PGO10423.6I9LH39UY5PWL10423.1W3TNH1JFO1ZI10423.1XVF1S619IJ3O10423.1P2ZPA79SUYHX10423.7590BNUBTSZLV10423.YCC9KXMDGXJY10423.39CNMKO4TZHPQ10423.6O1MKIZIGOZ4I10423.2ZMAZ4CFOVOET10423.5909A294JSYA010423.4D8VFDHS59IXX10423.MF59T457XWKY10423.3D9K0KYYPKMNQ10423.5SFPZ8R4DODNN10423.4135EXZBBR1WE10423.49M8K9HUB9KRW10423.R6QXNSBURP8U10423.3U4E4RILSLZDY10423.6OJFFI29T71SG10423.48DETQWBCTIF010423.7KNLUAD2L2RXB10423.75KP0KGFMDLIU10423.3MU5LQ2ILPQYK10423.5BS17M9XGEWZA10423.4ECWWEBDDN8E210423.45E2YRZ010OVD10423.715E2IV56CTKG10423.5CPN7R8ZYNFF910423.444AFFX9JOAF510423.2YLQGCQPGZ6ZL10423.108TS5L6YS1U110423.3JT0L84KDSIFT10423.LWT3FZ9QGCS410423.1LW4I8I36592B10423.C10NOQ689WNL10423.1UM1PAP757XQH10423.1ZKQC1A8UVJ8O10423.52E1MU3LAQJIP10423.22OLE3VA2DJV10423.24H5QHBX67VUX10423.1NKRDWZXABR7810423.5KN7MP8MHX0K910423.6N53JTGVP1XH410423.2J5G98JTR6DJ410423.1ALAB4FO46ZKR10423.5A42PPBCJ38RQ10423.6VPC28LFI40CR10423.2W7NIUN3NZG1L10423.4RDJCAHNDBK0O10423.5K9G9S8YLODO510423.3GZFSKFEAYDW910423.7AF8AH78UDH0110423.79PLP6IS58OCV10423.5Z7VN66UOQQZ10423.478MLADVUMVTY10423.5Y93VTPIUKMVQ10423.412XDK7Y2NMXZ10423.7I6EQG10W9Q9710423.6O3WOKZSP6G3O10423.1T5N5LQ8XESG010423.73PDQUVSOS9C410423.1JSEC98R1JC4C10423.K6LD8HBETFOM10423.2X67QGXQKUBMI10423.65AM8L65YK8DE10423.1GJOIKXDK90O010423.2RFECZWKOH1JK10423.2196O8PDYQHJI10423.22WUR3R0K0NL310423.5VCR4TJICPR9Q10423.6N7VI5XQ42OJK10423.R3SAIEQRS7R10423.3FSEBTDLEGIF910423.4R73VEN4N6D0I10423.11DY8LV7XR82R10423.7OQI7R4BSW8X110423.5OCTLRZV5UWNX10423.7IAQMQXYE904A10423.724O5TDPIUE7210423.7M5VMR5Z2269M10423.955QZ0PWYB4V10423.4XFL1H9WU6CYX10423.2SL1JI42O5PYS10423.43B8CZMHSIGSO10423.2CCF5LUCMTRXJ10423.1FT5HBV64UB2C10423.7HEYDH45WEVLT10423.7RHCTLAH522KL10423.3NCX9ILHH45PU10423.3YCAT3T5ZL88U10423.6FPUPWHHIZX6K10423.5WMAR0CYQSIOB10423.487NRFO63UTEX10423.24SE2730QPEQ810423.7M2MPVPHAOD7410423.39SFAMYW19QG510423.57H4JJR5LBI3J10423.3H8LG9SXRRVSF10423.43TR3MX6KN8IB10423.HIGY7U6TBWX210423.29JBBH4TWCPE110423.320D0UZ4NP79L10423.526A9DKCQQ8OB10423.6232MYULUO0XP10423.4BGK5E5CVSCS210423.5FWJAKF3FJCY310423.3HBCIUSVCMERN10423.7IE63WK9GA13L10423.241559SVVO02V10423.7NXH12AGVWNDS10423.342GV7MSMEI7D10423.4ZQNZ95AZ1XW210423.WFAHMR329UNS10423.5PZ5S2CRX9YVA10423.5GKB98HDA3JKJ10423.4QOL4RCFV1LAV10423.7A6Z2Q7G3TW2D10423.4ODI6ZH1Q60DQ10423.6MX44Z69VY7OB10423.VD9BR8L4XR1Y10423.490GWQQNRQZZR10423.2BDMWLSCGVHE710423.1D7K3IGLV3WBL10423.SASEOLX35EOZ10423.3NVXUGCQFS7IR10423.319L2GON50UMA10423.1722X621C82E110423.4JG8Q977RHU0J10423.1C0RJWN31VNW810423.54X4V7QI2W2BV10423.426YUL1JB1CE410423.2B6SUV3RHBBLJ10423.6RUOWITZ0U4AP10423.11UW5J8WSR8WJ10423.5QCW97VIZCDO610423.645OBLYTZWLYR10423.74KQIPBHSPIW510423.2LZJRY6GUQ09610423.53ZHZBAIQHBSO10423.4M7PCZU5HW2GM10423.69PDUFM7Z9V4610423.Y52QEUXZZWSU10423.7Z1LXTKKWKPL10423.12KZPCX0U93JR10423.54HL8J744P8JV10423.65PGKXM9LEC2310423.3IWIGA2UGBOVN10423.4I7S3HU740JEJ10423.5P8US71XQYO8110423.BOFJMTFZR1UU10423.1ERV2W1IHB4LF10423.3EM2QQJPXLBZY10423.6P273AL8OLGJQ10423.AX83T4V35U9310423.3ZUCK6UP7H7MQ10423.28MJDMDX1G0P010423.2PJOHMER752HM10423.4KNNARHIYYH8F10423.1123VZNBZ1AEX10423.6B340UZNKWI110423.160SIQ8DOOVX410423.1235DA8PJATU710423.3TUK3ALT4XNKF10423.3SEUT4N0Y5KAJ10423.30AKS2V9PZ54J10423.460I53VN7JJKD10423.2WGU2BHJYZ60Z10423.3HN7R8HO5IKIP10423.775U289HVWNJM10423.4WM20HZHQNHCE10423.2XLDDMRPDW5KE10423.ORRK7AZBI1CC10423.4JELIV4MREZX410423.6ONKSBWIAURTG10423.6GJDQVRWMIST310423.GXG24RUJM99U10423.7AKZCSFE3C60410423.1DY34RITAILX910423.58VOGM3WYK1DA10423.4J93DP4RLPXYO10423.542HZ1IQELHTJ10423.78CNHLJXJB42710423.XUZRSPV91XXO10423.4O4EWY93CALP410423.24NT8QXT5GHTI10423.2WTF6DEA7I0TQ10423.2RE8ZWAJUXHJF10423.NC3RY0VDHT6S10423.2SFAH6VXF70YP10423.VTQVHR9RUOU210423.3KRJX2YAGH5XI10423.FFO3YFI9650T10423.5N4P5LHMIRKEC10423.5SNR5LZJV4JMW10423.2VEEAS1VHWFJX10423.8M61SQDSGHF610423.51B5IWW0VWE2P10423.1WE424TCBFGUP10423.3RQC30VWTSGJ610423.7LG102Q53TYO110423.13BRNR7ICXG7210423.3N2DXPLEI33T010423.2KQ8754DPQNT010423.1GYIUXDH734CP10423.2S502J44JFM3I10423.TB5HEKX68G4610423.6LW1RX3ZHIG5T10423.2PN330K5EZVDP10423.TQX5GVODIOUL10423.4VL0J7E46DXX410423.7CY1PY4YP34OC10423.E4ISA853SEN510423.6A9JSGZHRHGX810423.4A79GCK6KZ8F410423.6D35GW5KOHTK010423.2QTG56ZKUB8UM10423.4OEFIPBPAM5FG10423.1RO38T59W235E10423.1RQUBE57GWM4M10423.43EWRAH2XT4TM10423.B70O6G3SDZ1010423.5OV4B1J6OW9F510423.6AJ5SK4X62DSC10423.1QN1RIJWBSJQ410423.728BOCRDTYU4S10423.16JK6IRCK3AOE10423.27WI6NS9SKL6M10423.5WVEWT1TYU5G510423.7EKVQIYFN1GYZ10423.6JBG0DVJY9CH10423.D5QJA64XU43T10423.2MVKYD8JFTRTA10423.1SCD1RO3X5JV410423.9CO7ABODOYXM10423.38W572OJCWBUE10423.2MVB5GJCIDWOF10423.6UJNDTP99NGT710423.31ZW2BZHBC59J10423.6RLABO85GQZCW10423.49SN5DVG78JOU10423.3LD2NGH6WQ3O010423.3LD3J7Y3QWBR810423.666EHUZYGECVV10423.APNAMRFTSRBI10423.TNY1I4DJKQWY10423.2EC8VWHQD1LW510423.54M4KVQRRHYEZ10423.46YLZJB9WBC3M10423.6ILPMM6XUBIPA10423.HY8MA4Y0M5NH10423.IPXWEA33QNCI10423.7KBQLWO9S6M6910423.O4OBR3WTUA410423.41RF7WI5CUIM410423.5HB37MRUSRW7U10423.5FDIPMNUGVB5610423.18IGL3K2PUZLA10423.1UNFZJJI214S910423.5OABGC87OA0QC10423.77RLPR0OFF8BR10423.549C0S7BE5NM710423.6JT00IH0U317X10423.4U5YRUKSMM4K310423.4OZ0XCZY6EY4810423.7KLBQ8CSCLAY510423.3630H6I3S917O10423.KSC4ZRL45SDJ10423.4PESLFAPDP6UN10423.45QCSQTXHSHR10423.FCX1DFKOBM1L10423.2HTWBWFA220A810423.3IFDZVMGL047S10423.3DIYLFKS9NRLJ10423.12K9TOP3EMEI210423.55KNWQKHU6LWO10423.1265D0GX7EZV210423.1360LFZD3YR6Z10423.5G6RXP92MYBMU10423.49B89XI3ZVGV010423.5HBZNL5LJ1T6C10423.71TEYC5P46N8J10423.480BVEJ0XRDIZ10423.7K527VLGYRS4G10423.4Z5TNG8RZZI5N10423.60QSTYI4PWYN410423.31R0TOIW6K5JC10423.4LX6WYAZD18N010423.6YCR6X59S8T1010423.Z353QP0QBIAH10423.14R8WJEXAM4IJ10423.3WSQL5X3N6X3X10423.1Q8MVSERSJMX510423.1XXX77XOR3F1910423.4LHED4JBBKRTD10423.5ZER2BX0U9BAY10423.2VHMBW1GF40J710423.D0HB9EJVEP7010423.4GWH3AXXI5T7A10423.3A0NMMHRXN3AL10423.5DYGY9UIX3HS510423.7EFVFNF4NVP3T10423.229ATTG3YJVX210423.6CYR6X323KGHD10423.4MOOR0TEBCAC010423.46FUBQSB0WXCC10423.74NHLABFDK1VD10423.5P63PM206458T10423.5ZXHUCZ2VHHZ010423.G7CIB3QI4EMM10423.2BJDYX0HPU6EA10423.5J8DWQ6O78M5N10423.2AF3KQYME6TWI10423.LO4E9LDLZWW010423.Y9M2RELMSMNY10423.78LK85P6WUYWQ10423.56X7INM5WDJC410423.DYL5OU6K6HQ910423.5VS3BGG66351P10423.6ZHH2IL8HT0H810423.22RTKGQSQONMP10423.3WNHD55IKRI7410423.2QXIL5SGZM6D10423.W36C3U0641V310423.4V8FF5HDXV34D10423.2758DZ183CYG110423.1SHV6XNZ2ULTK
GTAGGTGAACCTGCGGAAGGATCATTAATAGTGCCCTCTGACGCAAGTCATTGGGTTAGATCTGCTCTCTTCGCAAGAAGAGGGTTTCCA265.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0245.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0473.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0
GTAGGTGAACCTGCGGAGGGATCATTACCGAGCGAGGGCCCCCGGGCCCGACCTCTCAACCCCATGTTGCCCGACACTGTTGCCTCGGGG0.01133.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.09.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.060.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.015.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0845.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.026.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.026.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.027.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.02.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.06.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.049.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.03.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.01.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.017.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0134.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0
GTAGGTGAACCTGCGGAAGGATCATTACCGAGTTAGGGTCTTCTAGGCCCGACCTCCCAACCCTGTGTCTATCAAACCTTTTGTTGCTTC0.0408.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0
GTAGGTGAACCTGCGGAAGGATCATTACAGTTATTACTTTCTACCAGCGCTTAATTGCGCGGTGGAAAATAACCCATACACACAGTGTTT0.0330.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.014.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.02.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.09.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.0
\n", "
" ], "text/plain": [ " # Constructed from biom file\n", "#OTU ID 10423.4T6YHGRF7KF2C 10423.19X1DXDQX9QY9 10423.5EJZONDFDCFIN 10423.15PCQYUJZDX1S 10423.749Z5IK1KL20W 10423.11WHV0MTK27VM 10423.W7I8EQXO3BQ6 10423.21JY1FGU6UYER 10423.3NNWO34AYC1JI 10423.4EQEGELUCG05B 10423.2Y880KZBO0754 10423.DI3LYBHX9JY5 10423.20F5SYYEOOBTP 10423.5B7MCFODKXO4L 10423.B50D150HCD6P 10423.54ZN0NI5KGY9G 10423.13E9T6Z5UIC4N 10423.4Z32KV8UF4Z6F 10423.22H331G9CQEUO 10423.2SJFU0Q5WUQZP 10423.75M0X555G8PD2 10423.3W4GS7E9M3GE7 10423.20JHP9VC6NLOS 10423.13Q7F8TJQCL39 10423.24A1VTY597UXE 10423.1NS1SUJIHZ01K 10423.5UE7SYPSA13S1 10423.3LQL388KPP3IH 10423.BV9LDI0ZB7NI 10423.6CTYXFB4DI3KM 10423.YSLRXOXRAGDN 10423.2PGXF1ETMAJIE 10423.633W2VOM5U5EK 10423.7EFLMQPXQFTYY 10423.2JBOA2RMCI4J9 10423.5LRQ291V2NS0G 10423.DV47FMBJP9PC 10423.3BNPOL2M4OUJN 10423.74QO5APGCBFT1 10423.2WA6K1VNZQK2E 10423.4876SWOIRHREV 10423.1VQ2AK1VJFF3E 10423.5BTDZYFK4G8WQ 10423.3KWL3PYI9T5VW 10423.1BECDKQFVCT78 10423.4CQCOQ73D4R8A 10423.3BNGRFUC1F7I0 10423.5WQDQ61M5I5HR 10423.2WG5NQV6HSO0W 10423.59AVAKRTIFXU 10423.45LUC8I8L0ZPR 10423.6YS1WGGDN5ZRD 10423.3H55Z46MPQUT4 10423.7CD1PMJJ9JP4C 10423.E0MCLM6PEBNS 10423.19UABCDTCF7Z1 10423.2HZ5JX6V4HF71 10423.5N8B686ML457Q 10423.3J4QS9LQCP1Q3 10423.20X10T3MTSTMH 10423.6PVP8IEQXY431 10423.3A5FW49PNPG7C 10423.BSRFXQDHQBPX 10423.1XT5THMNV7A7Q 10423.7OAYL2KXUPF51 10423.9M3NWEERYBYN 10423.UYN0SJUR72BO 10423.5GSJL8096GWEZ 10423.32LESPIDRL301 10423.38B3F85A90G3Y 10423.JO2ML6MMONYZ 10423.4E6JT6MFQG4LG 10423.52GSPF3IVL2HX 10423.36K7B942QIP33 10423.768823AFDO53N 10423.43BQ7A31Z1QVY 10423.2HB3SCFECHDFQ 10423.3E78EE3MAR8B9 10423.6YXS307M1YGO8 10423.2LJA9LF5GWHFH 10423.2FY40MYZRQCP 10423.3Z5TU33L343VD 10423.33C5VCBYG37K4 10423.3GA24EZ7P38AQ 10423.2T91JJXPRTBJN 10423.PE0691T7DO4J 10423.4XSUK3T0JVPRR 10423.40KMOAOMJMA6R 10423.5I4U9ZTN5E6SS 10423.6JR5DVUTZIF77 10423.5U2A6WVEE6UTF 10423.3R5AB6CNPWKSQ 10423.681PRKKLDZP2L 10423.3O4F3L3WFF7EU 10423.AG8PS5M9PMDP 10423.4NK01RNJGTCUF 10423.5O234CPBRWNVW 10423.1WA077NS2JLY1 10423.57L7IPFT014WZ 10423.2HLE707788SAX 10423.19MIXT3IWJXE 10423.5AUKV6WN4BQA6 10423.5S1YMBRGHFQRJ 10423.3FCVKWB4AFWQH 10423.1RCOCT8D0XCDA 10423.7CI14QLXEJ8WA 10423.18ZWCBEBREAIC 10423.6OVC5SFQUV2NU 10423.1YJOUQOVALZTE 10423.2RORFXTPZSBD1 10423.4165EO7IZV7X9 10423.3XWB3NR1J7KK0 10423.4XGRACCUHW52A 10423.6Y6J62XH6X20V 10423.3G8WRBD6VJOAL 10423.2WH2ZGPU28T2M 10423.7PX1U7PKIUUAR 10423.2VYBBO6V6UEBC 10423.3MUVHEAG1CG09 10423.5K9X8B8LY1FO7 10423.1RV67P24YVVZP 10423.3E3K03915GKAB 10423.5SU5QQD5R3IJU 10423.5D5FRL0O03W8W 10423.26BHBLZFQQNV3 10423.2SVSWOVIWA6U1 10423.6WQMGOF35N6TO 10423.6RDI2G802KGFA 10423.29YD3V7NO092R 10423.H9ZP330TOX0Z 10423.22C1WEG1JEEWA 10423.61YQQNXOCOR2M 10423.1LMYUJ4JPBR65 10423.5CROEO103V9CS 10423.4LCE2900CEZY7 10423.2IC65EHOQX4Y8 10423.5NGKDZ6FBNQ5E 10423.H58BCRZXSS7G 10423.4U8QQ71N1MVMJ 10423.63HEINFZYT591 10423.38R40FOBJKBW0 10423.5MQ0GYNB22SGI 10423.3S58T1HLJKNFF 10423.1376UB2AROJAC 10423.3LALDS6G9BFTN 10423.1KZEX8TN3UZI4 10423.WXBDZL7NVCA5 10423.77JCI00VOVNE3 10423.5OQKYOZJ23JK1 10423.53I33UX6J48YU 10423.4GREFKC5QDM7A 10423.NIPSAY33YK11 10423.2ACCI5YOTCAXA 10423.5JDO0IF63U95O 10423.38BL9ILUFJQ78 10423.7B30959IOXNMH 10423.56SPUT4BXK09 10423.3M3DNBS131EB9 10423.5PFJ684QKDI9U 10423.2RJ9ARTUU39EL 10423.2QPZ6XRPTU0TP 10423.2W7XBRCALFB6G 10423.2555QJ5K9VHFS 10423.RE2TOXH0V54S 10423.462BVZ0X7XXHV 10423.2H3CEVW5SH2LC 10423.RZS4CM6RRAS3 10423.6TLTXN3GMLID7 10423.79X6ICW7ELRAG 10423.59KT7MBTH5JX6 10423.QXL9YESDY7CO 10423.2CAUBVXCPP11O 10423.3BFHCLJQ8BHP7 10423.PLJIBTOIAK0I 10423.3JCJ1HLVQVKNP 10423.2HGLXIF9I6FE6 10423.3JY1RV4S74IE7 10423.6D2WJQXAL86ID 10423.43ZJ1PM8NS5LM 10423.4GVR7MQ02J45L 10423.6NRJLWUFPR09C 10423.3UT3F5FJ7MB24 10423.PJOVP7HNPXZS 10423.25VGQEGEG6S31 10423.16O4ZYWK5C7L4 10423.KM445JSIU1DE 10423.5AN2EVLONL2HF 10423.5R66D1XNZLM92 10423.4UPWOI6P5QBEQ 10423.MUO0Q6MBYI9Q 10423.3WO5RPRW1Y077 10423.15FIPHXRBPL89 10423.44V2DU7R2CN2G 10423.AU842WNF1O88 10423.1QUT4Z34VSUKI 10423.UIMFL0TGN6JM 10423.1Q7A3G954IAZP 10423.4DUM74S1ULVMU 10423.2ZKIPCSPMXHIX 10423.MITO3YQD8KLW 10423.44F1SMOPRSRAE 10423.7QG2F5GTHIW3O 10423.4XIC429UF0VY5 10423.5T3RQTIL5OFEY 10423.2QSHCDJDBEWRA 10423.1ILLSNF88B3OZ 10423.3XYT93IP0SGHL 10423.6SVQDTFCL3NPZ 10423.60GXWQ4F82EQD 10423.2ZD6TBNKGU1MZ 10423.3LQ44P8XDC1IF 10423.51CQCMT0T14YK 10423.76VTGH6VXL3TA 10423.16HWZ4ORK0GKZ 10423.UG4A595Z2AM1 10423.4XZA0ZNJA0WRX 10423.5FO15O70LQ4YS 10423.1WA94CW25T8ZO 10423.4FXOUAVXC7INY 10423.1SBGLTAD6VMWM 10423.4OO9K68HYAH8Z 10423.2O7DSULD87S3T 10423.5DO6JM2Q1C2WY 10423.3MBLZBAWZER5P 10423.2PP5R0XPINWCU 10423.2G089KX84JI6X 10423.76LQHV1T6N4Y4 10423.62LCGGX0JJ5LP 10423.4MDFJJLDWOJDH 10423.8AWUBIDDSQGN 10423.1U0ZXG5Y1C201 10423.6E76XWZ5WVJ05 10423.1O8BB7ATVSIV9 10423.2N6BFSJ2TS0LB 10423.2JR7WRB0AOYB9 10423.4QLM0SL513ND8 10423.3I1VK3V2S14DB 10423.2THZ5VJVZJEHE 10423.4OGA5BXW56RG6 10423.3XS78QLHABPNC 10423.1V5YQ6U6U5WHW 10423.7BEHI08WCOTJF 10423.3MCCQQZR97OAM 10423.52RS3ZMCCSYBL 10423.4YR5UKVDDGYB1 10423.40754AE5KTIFI 10423.4B6JJN2QXGT1Q 10423.6BAU6WT5F0NE5 10423.1JF3XV8QHNR8A 10423.4VGOMWH6OEO21 10423.64X3STES5L8IX 10423.6RT0TDAH6L242 10423.3L7TFFPLUAOR7 10423.7I80FXEXNKP8A 10423.68WBRZBG841HP 10423.33D3726M0JCLU 10423.45GK8G9QOFCPQ 10423.7A3LZ8QQ4QYAM 10423.5C0AFD9Q6YHWY 10423.7E0ID91K0C38M 10423.3VTQAS3Q857M6 10423.1ZDVEJ4R155CS 10423.1MPWGD0SCXRQH 10423.15ZDCPX5XPGS4 10423.4EU2UPGFHQO69 10423.7CFJV2B6R4L1X 10423.7EQCZXHDYKAU7 10423.2RX9KU1STLJCC 10423.1736SCZDWZR9U 10423.4URIDZKLX1ADT 10423.6K3QHXRK819ZY 10423.2RKWI5WFU63I0 10423.56C5QT2WSHNLO 10423.61NZDH684KA7D 10423.KP43VS06Y7E9 10423.4WBANB81IJ0H5 10423.4HUAJHJQ57RNA 10423.7FIB76UT4YFKV 10423.ARHX9DMODDC8 10423.3C3HCNDDBZ3A2 10423.VTZSMZJV4BVP 10423.39NE3ZYO7XQHR 10423.FYEVZHKAEBOV 10423.397EEJWJRK2SX 10423.4F6WVWLFTJ60N 10423.5JZ5V4H5PWYSY 10423.1ZXIT3XP7UKN 10423.2E70JN724SF2K 10423.75R180OGFEH88 10423.6MMBW0XWTNIPU 10423.2APMWJYPD7VTC 10423.56EEZ3MA6SWHM 10423.1LY768VN9TA1G 10423.NLFZ4H3UMUX1 10423.5X6O4A9UDHWEO 10423.7BGZNG0JU9PH0 10423.52WSEV5NBYQ6R 10423.33XOLPUUWC5AM 10423.60597TIBFHSTE 10423.3GU6KJNT8IYZG 10423.6HZBY6YYWKJ4M 10423.74CZ58S98P81R 10423.44WGO321Z5U48 10423.5FK67W9QG3X3R 10423.6FSCVC950KT45 10423.6TL41YVJ6YTBI 10423.47P50SDHBQ1PA 10423.6RLRA77ST41CY 10423.6E27ZMAHIUFO 10423.4QBBM4TC5C8I1 10423.6AV2IUIE7QENQ 10423.4GMN1U14UHHDR 10423.3T3CNGX88CFYO 10423.3HWMC33HPLPGI 10423.7GBLB0WY57O5R 10423.5KIUUMUS5RILY 10423.7D5TZ65439NLY 10423.4PJ7R5U4SSS0I 10423.6GU48B2G0H1L4 10423.3PLI1UP84EUPE 10423.5T3HXWTE88KA3 10423.7IZFX4UVT9BSG 10423.3VWBBU19TGO8 10423.1V7AMRIWO10C4 10423.1SWHHWCPGLAJU 10423.15R50QEA1C3XO 10423.6LVTQJCM8F17E 10423.58XA63HTPV0CD 10423.3ZG48QVDYVIQK 10423.70PMEGKDZ2KU1 10423.4YU4YJMO7EW8O 10423.2ZHAO8T4PPWJN 10423.6SK2KOA5MP9W8 10423.1VGZ0ITX5K0ES 10423.5JG65Y6TLF539 10423.5VJUZGXA9PS79 10423.G375H9I0GOLM 10423.5DYYSKB33MRVF 10423.6UKM6N5GSJSWJ 10423.63P5W3Z8ITG3F 10423.2A4D3BO308L4H 10423.7OLPY9CE2TW0A 10423.3J7ZP52842USL 10423.3A733ICANSAAR 10423.1FFN1K3SBVB7V 10423.5B5C8DO3CG75F 10423.5XBOF5T5CNO9U 10423.4HL6DOUUX64VG 10423.50BOVC7N8RLJA 10423.7F0NEL96UBPPE 10423.2GAB872AVHH23 10423.43M0LXUUUT5R5 10423.1BHKEOQ0SKE6I 10423.665Z0FLV2HHXF 10423.2P0WTTVSBQNQC 10423.487EUAFW0L6DA 10423.7HU05V6ZO2FAJ 10423.6JI8NBPKLYKCO 10423.2KYWWBI9U73P4 10423.5T8J4JTM1KK8H 10423.4U8GXACG470HO 10423.5HTLYA2JKWNXH 10423.7G26Q6B4L4J7Y 10423.3O6X90VJX03CF 10423.64DOM7QCN6JUS 10423.21091X37R0ELR 10423.68U2JOS2TSSLR 10423.4W8KGHP0RUPL5 10423.49EGB1HOX31UA 10423.4GLGSYY76RPAE 10423.3H4XXQF9GNFUP 10423.1C4ODKR0HFUZ 10423.262D5TAKIP139 10423.3YN26AKM7PP43 10423.6HL53UL7MF1A2 10423.5MYILUVDVW0FT 10423.I3QRG4T6B7LX 10423.6M422IVI4SE1U 10423.2LLJHVYIV7QBF 10423.4QW4GU4B5YH6U 10423.3GUFHOW3BSM13 10423.2SQISWN0ZOJU0 10423.7QR1TPZMYQRXC 10423.1CP1CV5X2Z4LY 10423.1F9GHTHJOZR9C 10423.7PUSLX674JLET 10423.J521NFDO0M62 10423.7H2D9F7FNW0T2 10423.FM2P2T4553XR 10423.2S50YAL1DLU6Q 10423.71E48SUL99GI6 10423.5P0MG7J1ULBDL 10423.7IW9D4GUUHXUS 10423.2I9WX3YBCLW2A 10423.6M6C6KVSD9V10 10423.2OYEOE44U5RSR 10423.39NEZRFL23YKZ 10423.2AUV8T9DLH2MX 10423.1JEE270T2126L 10423.5S4POWRE2A9QR 10423.2BYFRB3BHHQ30 10423.5ZH0AMGE8KK6W 10423.14QKHYSJTFMIG 10423.18N8ULC0FXCI1 10423.5RNM49RX14X64 10423.4UAR1CCQCOHGU 10423.3QMJJ5ALOOE4O 10423.4VYYGEJLD9SQ1 10423.1J3VM5HMX68CZ 10423.45V8X342544NK 10423.XQUEYVMRE7WO 10423.59GISF0FXMH3P 10423.4LF54TZXX9IXF 10423.7GANZB2AKRJ41 10423.5SGEDTDHUUVNQ 10423.2M1T08PU91954 10423.1B6T1HYKKFXB9 10423.1LBYK74TDXN99 10423.DW3092J2LLSO 10423.4OZ9UI889OL5V 10423.O4W1HMG77ROE 10423.1TLWNYHKB8B9P 10423.38LVO6DNBB52F 10423.3M8VSHRW8QG9P 10423.484ONGWV9WVHA 10423.2X8YT1XO5OULQ 10423.9NGG8K1FZNW3 10423.24YBOSGZABBN4 10423.53NTAEOEXWPVP 10423.286ISEUVQW4WY 10423.4N3QJEW82ZU0Q 10423.5ZAEA9J6I3TCN 10423.1EY863QG4I8E1 10423.XBBO1T5NDM7W 10423.6SNH62FJUK2SB 10423.6VO5TDIHUE89E 10423.4LRTRQS27WD1 10423.T0EZZADSA7C5 10423.25Z6LSWJJXN5L 10423.6WKOU314M19WS 10423.5I7CFFLAMZ2QD 10423.B20DAWST875U 10423.1Y8FN9GUVY8UV 10423.6Q68KBETWZ5ZV 10423.7REUO5ITNH6N0 10423.UPHD36BADKFI 10423.3UZVDGAJJJPQ 10423.33K71PKDXJDJD 10423.T9BQJFN5U26O 10423.39W2T6CKCE6DV 10423.7A4A659WSU30 10423.GTZ3VJZJ518X 10423.3PD7YC8IJP1OI 10423.5KNFO2ZZR0FIO 10423.17DY5JQU54853 10423.276EMU45R2QJE 10423.4ZCWMC5N2TAZY 10423.1NC17N0H7F49I 10423.2COCRNOQIO0W5 10423.795WPO55PE4JV 10423.ZRE0XQXX8QWZ 10423.6LR81BQHSZW7G 10423.FXXXGHWY19OT 10423.4M8SAQFEKYD3 10423.5WGSLUD3L3GPV 10423.6WJQ19KX34XTG 10423.4A7IDHSGO8VGR 10423.1K7X36B85JXT4 10423.5VML6AGB0E339 10423.5NB28T6K5YO6Y 10423.7MAVXMPA17Y4S 10423.70LRGON3TGCZ0 10423.6RQJJOZQJ6E9P 10423.3DNKAN6WP2WLH 10423.5XMNTQBYTVK3I 10423.2EYXV53KH0BQ0 10423.Q4AACVQJIQOK 10423.5ITJKDQKKEIGY 10423.4U05R9NYL97H 10423.3WZ621RMDC443 10423.5NMYZ3K17MP2C 10423.16A5LO5J005QL 10423.7HMYO2VOJOTHU 10423.55ZBPLXWGP5RA 10423.2OJ1LZQK6M5XK 10423.383KYWUBS9SB7 10423.5LTZAJL8GZ0WE 10423.5HOTOSALUUB0Q 10423.13R2DAIM7UMXF 10423.5G9JW1PX1Z2PA 10423.F24SF77M0X34 10423.7V5697M6IHQ8 10423.1KQWSCLKA1RIT 10423.P2IXE2FJMI7L 10423.21FIVOXERRD8W 10423.746R4EKGNDH1M 10423.2EXIP4SCQ0WL0 10423.4Q18NIO9EE9MV 10423.58X18Y9JMLDAQ 10423.7R4T6MZAUZETG 10423.31943XOZSNSM8 10423.3KBS90NJ96X73 10423.4SCBLAJNJ9UK0 10423.4W5SI586CTYIP 10423.4MIYKH25WJTF5 10423.4GAQBJNNSTGID 10423.1W2L16NJLMPM 10423.2VYK8TF5A41CZ 10423.6Z01BAQZG9PK6 10423.5XZGDTVF77UWA 10423.5615GH36H3JOS 10423.7GDF1W285M239 10423.41MEX0YUDOQQY 10423.27UOFSMZS6794 10423.54933MZ1AW0KK 10423.2YTIPKQUV5PX7 10423.2TC1JA5XFXHKI 10423.21STA2XFBMY4Y 10423.61ZLOPMQU6SWS 10423.26OZRDQTJPNPK 10423.18RN4KEJ0UPKO 10423.2S0O68771GC8F 10423.C11JG732G4QT 10423.72V772FWY93SQ 10423.5RWYBG85I9YWD 10423.6XUNXP8OE0W9T 10423.45Z3UV1CAQCIL 10423.6U5A008SZ6F4K 10423.6OJWE11X5K3SI 10423.59IB26K5ZKNZL 10423.7LZVNAPJPTU7W 10423.7R8HKXTW0A2UE 10423.5XMOPHSVO1S6Q 10423.4ILJGETV096AN 10423.79EEUKD8J7CJ6 10423.L2MJNJDZX78Q 10423.4MYZ5OL773P77 10423.78SO2T2YTUZU9 10423.1XI4NE60PMY7M 10423.79GO2UWLXILF4 10423.6W6OK0T6MIZZ1 10423.6WTDJ9F0QHPSW 10423.4S2X0FXTZ6PM7 10423.3C5ZI350TJZ7N 10423.36P7M4NDPOGY9 10423.2TSB1MX8TR0E7 10423.4C7C3SFUEGPFD 10423.63KDMM7ASR36O 10423.5RE7JF63H1S8B 10423.4KMAIFBWAX5AZ 10423.CBJ3Q9CD4QH7 10423.RYUSMRJ7B5QD 10423.2526MKE9FXJI5 10423.GJ7QOSJB0KDO 10423.2CQUX3GE08WTQ 10423.W5FKEDDKFAR1 10423.6VZLL4WBJP74Q 10423.6CBP3X8POMYWM 10423.R18SHSGP2NAE 10423.166ANW88UDXVK 10423.23YD6XC1GN90F 10423.V38Q05Z6M7BM 10423.3DA9W96W57BPF 10423.6AR57EFIZ63L5 10423.54K3DYYRMA4HG 10423.2ML1MK8GGSPWG 10423.4FBX6S4QSOXVT 10423.1BX35LSHWKZVA 10423.4IYC0IDBDLH3F 10423.5BALGEFOEVM28 10423.7NC6C2IXOR4LP 10423.4GD7L7YEG84CQ 10423.4R1DOUVW8DW3N 10423.1J9CVK0L8P287 10423.1FDL918RV8XH 10423.3XO1VWR8SNZMC 10423.3NM2X7Z0XXNM0 10423.22VHYRLDVZBNN 10423.2CN7EK2PP4GW0 10423.67PS5IQ7I5G3Z 10423.1U99575QRVMXP 10423.1LDLRL7EE0HCO 10423.46KDO3BYNPN7G 10423.M1DWW4HBP9OU 10423.726OGYOSTW01D 10423.57QHMHOAWMRX0 10423.26FMOFTO8EDW3 10423.77L8YWPL1Q27 10423.NIGV5PT0OWZE 10423.VAZ7P8AWGA2S 10423.2PZP2TXSHOY9O 10423.N7YF46MVU35S 10423.6J2P0N66NRQKO 10423.16TTPF28LOHGD 10423.2WLFRJ3OEEB0X 10423.6UP5IZP4FCIRN 10423.5CXOE4HFG3LEI 10423.1D21YCGQPEUD5 10423.27IZQW0VZLLC5 10423.99P3BKDJR0ZZ 10423.1SGG0XCRBV6OK 10423.3BHQKW33MMQL5 10423.6WRYD93SZIANW 10423.28HJ2QUM2A8TU 10423.4XT3H91AN5CTE 10423.4PV23S20RIPOC 10423.605A3KZ89O0WM 10423.4PO9GCQGLZCE 10423.5UISMEUZVA0OR 10423.5ZD5CUJ42YCBV 10423.3YV3CNT1P5V3C 10423.4QWCI7VOF1W59 10423.3I8QHM0KLRI97 10423.460R293XAT6M0 10423.2KI7WJCV2GPWZ 10423.7OLQU0TAX043I 10423.6JVI5Y8OBNX5I 10423.4GVQBV938CW2D 10423.3S7QYH9915JD0 10423.7C4LBGD7UFXB 10423.2E1ZD06UBGF46 10423.6BPGHVHVSRC4F 10423.79WGMOO9YZ28R 10423.7PXSLNEESNRFO 10423.JYK6V8VXD9PD 10423.369FY2CMIE87U 10423.1TV0TR6FJ9Y1J 10423.71TVWV5CGJP8L 10423.3V9LUNF4OPGXG 10423.2L98S2VMOEPLX 10423.5UFSMOMS75UNW 10423.6BN6DTHLK9V59 10423.5RQ49PJKIPT3P 10423.573D6MRHP2V7F 10423.7R6THSAE610NR 10423.32DMJHI8DEK2F 10423.2GC3HYM0XFNXZ 10423.6I4U3CYU29L32 10423.63EMKAZ5JSE6L 10423.3KM2NOFC4YC2A 10423.7N2U4W2P7M2VG 10423.4Y3D05C6OQJLD 10423.7O88E91X41491 10423.2795PF43BX9IM 10423.7IA0R2Q0YMB2L 10423.15Y1G58G3UCXW 10423.3UNU74NY56W5B 10423.13PA3IYW5WG1J 10423.6TTW1X1OT363 10423.O47MX02Q19OB 10423.6ISD4VSTTK4NV 10423.4NHHWBVVZ8GWU 10423.3KF7Q69UB7Y6E 10423.VZ03IIUUA3QV 10423.1GG101JP94KQA 10423.3X8R6DG4XQSVZ 10423.QMT106FBNIE7 10423.4R11SID4NB9U 10423.7H68774PTI8O3 10423.31PLNO7OFKQEC 10423.3DDPDET778COQ 10423.68GK3X0P0TSRA 10423.2HPJJU1FPWIBX 10423.2QKPYX04RELWW 10423.7B0I3PHV7CROW 10423.6G4IIRUW5IH16 10423.692R8V5YY98HV 10423.5WL5DWQXX8YO6 10423.1GX6YCORD80IH 10423.6GJCV4AZSCKPV 10423.T8NBYT9ONK6L 10423.63ENG2G2DYM9T 10423.3L7UB76IOGWUF 10423.750A5DUVQWCO5 10423.2P6N0DN0QJ4N7 10423.4L44UI07LVF0J 10423.28UBMUE2FMJMM 10423.2DIHTJFY0FBB7 10423.498Q4HQGIAKXF 10423.28C0XKUQWL6VE 10423.339OLO17SOJPR 10423.6TUIMTHCR1Y9B 10423.122GYPMC24BU4 10423.5JK2LMSRZT82M 10423.4V6EMCLMB1AU 10423.ZW6AFIVNB3TQ 10423.102EB9QO8MUTV 10423.1CGCNOS0YIOPU 10423.108KV0CWVIESE 10423.3XWK0SZBMH7LN 10423.GPFRJ0BWCBDT 10423.3NXC4P71CLEKJ 10423.Z5W6BOYB619P 10423.1N7XCPUWYJ9CU 10423.1LCOFVCQTKCAY 10423.79DOYW5B3KNHH 10423.5O7LB6GJAMU3 10423.4T4FG9IUVTB1J 10423.61K2213CVZZ4S 10423.6XRWV48QT6DAL 10423.OINEEM43GEKI 10423.2T7PMZ8ZXY7PF 10423.5YHD3KPBL47TE 10423.7N53D6M2LXBRE 10423.1A7SR4575E7TI 10423.OF7X8ZT1FDL7 10423.5G9J0A907SUM2 10423.22A85JARJ00YS 10423.7J41MCH08OGSE 10423.1HUBZYO6J3GYE 10423.53IK2DWTVHAYW 10423.48SONIQIDKH25 10423.56RGGCE0NEUC1 10423.7DK2AM4FBVCI4 10423.7HI4XHI6V69JH 10423.2CQ6IIU0J2ETN 10423.6P0LDT7BXAHKN 10423.3JDHUB239RWR1 10423.22M3DWZKBW6PU 10423.1DS5I64UQWP0D 10423.7F158VPR0UZSO 10423.7AR50RKPW1HVF 10423.5HS95XWWWVC01 10423.4EOTMOOUFB99G 10423.4OYS07RO35B2L 10423.67CALIFQJCOCQ 10423.3NA66XLJW9MQM 10423.4QCHUZW9T20LE 10423.4B772G87KH2YL 10423.5FJ8W6F2VNS21 10423.5D35NJ0DRMF9Q 10423.24D1VK6CXC0Y9 10423.3EBBDJS9PGV4P 10423.5NTT0U8M76UV0 10423.2STISMV8NSPUV 10423.4ZY7BBX69YTS1 10423.6H7MO2TTTG1FL 10423.4N18DZ4KLEY35 10423.682KPM9NVHQWR 10423.6M5UCAF86QKXQ 10423.3SQIM9S7WJY4A 10423.5F15MYIHHFVAU 10423.6XC571XZLW4K6 10423.4R9YXQN7WYBH 10423.3R17C0O0B6XZA 10423.1P4BLUVZMQ2C5 10423.H28BMJS9OM6L 10423.6RR0I7ZDVJG9R 10423.7IQS3PXWIZ3ZK 10423.1G50PPJYXQGTE 10423.7RC3LKIW2MNNS 10423.333XJCT2JPUPO 10423.36GIWY9HL8125 10423.6GBDGA0DZ8UX2 10423.38GUHJDFHZ541 10423.6GVAH65DO6TOH 10423.O9PS2ZXVQBMR 10423.6WTVS59CX96Y 10423.5Z1PL35ADNDGJ 10423.4B0RLKDOUBVYF 10423.4SHKTBB8LP9GT 10423.3V2GI3COIXKVL 10423.1FBYN9976KN6X 10423.2360ET4K0U5H9 10423.6547NGSK2L9GG 10423.DLCIR0XSSDA 10423.5X6W5O17MLBD3 10423.48RCQY1SJPD7X 10423.707BP712G182T 10423.24IB3KXXZRFV2 10423.6WALVGW1V3B1M 10423.5RDXQIGWJLX3G 10423.5K771HPL7D4S7 10423.1WODL148D0NMO 10423.3GXU331HJNEX6 10423.6SUK4YCEXDVMM 10423.5CK5YCQ1N4LK1 10423.WCIJAA8N93LC 10423.1LK6W6NPAB03P 10423.69SUSOU2ZR353 10423.38C0QXZXTGL5O 10423.343FO1305AUAP 10423.7MLF9FPD0901M 10423.7I58HKY38JY5U 10423.3XJ9MEZB2LMPL 10423.5N3JSHVLP80E7 10423.4TUQG4TP24LOS 10423.2QQ78BJ32XFS4 10423.7HVNMOIGT4XE 10423.1IRBZ76GN3KLU 10423.3YI1VF1B8JX8X 10423.7K4U6HU3POD61 10423.1NHAFNS29UJ6B 10423.EI181ZIWREHM 10423.618TQBC9BIG9H 10423.44O7GC298M96K 10423.2RBYVUA9MG0K9 10423.2K84XX7SBIR1T 10423.KL08YMFY2CHL 10423.6YF9CCWX9TOYL 10423.5W7MY4ZK49YTP 10423.1GZ9MD2BGW1HM 10423.3ZQMOSEK3QCK6 10423.6J8VKDSFANAJ7 10423.6ALNXZWKNN9PX 10423.7H3P5ZW5HR4NA 10423.4R5A4JHUMRZ30 10423.2HZDLAY8DKU5G 10423.5G7IP4XWWR8RR 10423.3O83HVYHKPVFS 10423.2LJ1CG6VDMUDU 10423.2B84RFSHB6FFR 10423.77FIFZKIDFNMA 10423.5FTJAU6VRF6X8 10423.411BO2U1BCNYW 10423.3XO9XAIM1REKR 10423.78MX0HUTKWAU6 10423.1Y1E5H5JRKN26 10423.3GF2FAIIO905W 10423.60IRNL9P8GSNV 10423.2A43AEYW2SPZM 10423.337TZ1F0Y3XP1 10423.5LW9ELLIPGHVK 10423.1JG19L3E23WA0 10423.2XUPKT7XV17AN 10423.1FMQW7HK8VC5E 10423.7LYJQQ0TVYQDO 10423.2G7K5M2DAMY2V 10423.6WZQMH3YDOTLI 10423.626I44GWWP1X0 10423.1T27OG3XVDRGP 10423.7BGQQAS9R02FD 10423.4W3B8GXFPFAOC 10423.2DTQ5971KWU6I 10423.3EEC91HE7R98S 10423.RB2TYP9CQZ3X 10423.2EI8VCY5P9XXV 10423.6NFDYH8OKTCCB 10423.61I8B5Y2VLL7A 10423.BT0D2YNKZYRK 10423.2C1EV9UMBFO0N 10423.6UUWLAX9OB7RQ 10423.6ZB1LMQPRNTH2 10423.4Z3KF5PELO99P 10423.212R7CUV8LAJC 10423.7671T87HPYD0A 10423.5EEPKV4XGQSIM 10423.47KK7C89QH4SK 10423.5JDN4QY99O12G 10423.2G65EEC8V5B4 10423.1ZYGT6SZWXY1K 10423.2FITE4JVX6FD3 10423.2V653122RCUM9 10423.TB6D61U0EO7E 10423.2CP7PPDT062QB 10423.1QDN6NY2RPESB 10423.3CRJ484U3Z51D 10423.15BDCO3IU1V79 10423.56ROHQ5DWI9AG 10423.2YAZ35Z98UQ4C 10423.BCITCFYY30ZG 10423.4JBTKINSCE8UO 10423.QX3FNY87EX9E 10423.5BNMXN7EVHJWN 10423.38040NMGRSKAA 10423.5BB3AOW8LEW5I 10423.1KQOQYU70YCKE 10423.7RXMBY1SIVLEA 10423.14VKSUBUSLEDM 10423.I3ZOLD39KUNK 10423.5H7UARBD1E35C 10423.6YYYBVAJPO8RL 10423.DIKKHB59MLY7 10423.72RIDJ7WJ63U 10423.72TCKFTQ3OHS0 10423.6LY2YTVZMQA3C 10423.1PIBVX3XM8C9W 10423.498Y5VHTRDZVU 10423.6KGJ21B0LDKSQ 10423.3EZA5X98ZNXO 10423.7MNOHQ8QEK8XK 10423.4AFQPHBCKM8B7 10423.4RXMWNPC2L2M6 10423.PBXI8O93PN5E 10423.4QR3A743CMH8G 10423.7CCRWPUCC3TZH 10423.46LCGWS66LZAS 10423.64T7D4STR75JK 10423.2YFIFIIWVNFZG 10423.3OBYFNVRQC3AT 10423.237U5O9U18JER 10423.1LPG47FACQF0I 10423.54Q10KCQ5W1EC 10423.404MYUMI38MHX 10423.7J911GJEDO0KC 10423.184Y5BSOWVZQT 10423.58FX8VPC0E3O 10423.2YJNSCD5DB60G 10423.6TFTY6N1AD6BH 10423.4K99WY12OHFJS 10423.58E9L5QKR6YJG 10423.69MVOZUKHOZ6L 10423.27S6ACVCALBBJ 10423.3AI3DUC0Z6E7N 10423.6HPOG74V97R56 10423.O1HG3H1ZCYSB 10423.5W2MN9G9546YJ 10423.47UE8T52E5GM3 10423.4CVTY4Q1ONL3I 10423.1K8E1PAVHWZT6 10423.3737W6VBP6QW0 10423.28YPWTGL0JWP9 10423.7NUH1C297SHCX 10423.7P9ISOVKRKAPY 10423.4TIV7R4W98FXQ 10423.TUUVICBMB6Z 10423.29TKUDFPXXW60 10423.4P87GTUEHEO3M 10423.7LRW8GEXWQ4F3 10423.4QTLFMVQU7D61 10423.3QHICIADVCE6A 10423.773BWSHUEBRM1 10423.4H1HE6H8HBL2G 10423.1FBQLVHTXH88I 10423.6N4UMO8LLSAFH 10423.1S87OXTVFHTU4 10423.3E631AHLH7OB4 10423.20ORT23U398OT 10423.L2UL1AR90M75 10423.2YC5C126WKI7P 10423.5276PBY3H05MT 10423.3UYLKBFEDBD0K 10423.7CSSHXDDMNPRJ 10423.1ITL7HPU1ETHS 10423.31F37MOIAPWKQ 10423.2Z4A2RIB3A6SG 10423.429H00T6SM8BP 10423.JFKHOYJSVFZO 10423.29OKJHWEYS4AU 10423.T3TLDFS05088 10423.2CUPUVDO5V4OR 10423.391W9DWOLV0UH 10423.2TYHLDJHGMKCQ 10423.K0UAX965UQOJ 10423.7DRSPIY7XA0Q 10423.7E9VG6YPBND23 10423.3P1DLQ0MKZ40O 10423.7OMW74FBQJO3N 10423.5J5ESRFDDAO80 10423.7P99VJNAOANOB 10423.2Z6ADWTEEBSMR 10423.19T6G5GGRNJ38 10423.4YRVQ93AT3NCQ 10423.5KEPHT0JO3SKY 10423.269H0GOCFP20S 10423.2KEZVFDA594XP 10423.3VD7VA44R21QU 10423.F4NTMFRXS13X 10423.1ZJ4MJWC3KK9L 10423.55NN0PBSO4JUB 10423.1QWDYP04SXLGD 10423.6FB8EXSR598GA 10423.27AHLZST5SDCU 10423.ACVMAOWAMOLY 10423.3LMI42JXAZGP1 10423.3SXLL5P2ZDQYL 10423.4U5ZNM1PGSCNB 10423.61MU0DK7B0Q78 10423.6J3DF7SK4Y8KR 10423.68QTMTBL2EZJ9 10423.5QFW8Y3QNGJP1 10423.28AG3UXQZGFZJ 10423.73BOQSYLL61KU 10423.5JXL1EK5SS7X3 10423.28AP10612Q316 10423.3HDF6V6FGAFQS 10423.2KWEQVQMCM7RJ 10423.19SXJ086ODW1L 10423.7ADVI51M6C52L 10423.11GGE1MVFC40C 10423.7HOYZ86RUQFC5 10423.2U23M08HIZ564 10423.14KTFNKEKGXID 10423.710LT137GAGNP 10423.7BUR0D07QICD4 10423.13COZH25XDL8S 10423.5GCJVRY4Q38Q5 10423.3IXWQIX5D4VXF 10423.6Y1IV7E67RA5P 10423.3MRVHO28D89ZE 10423.6RAA1C8F5CVG0 10423.24P55BMIZBLNQ 10423.5QKOIFVODIWLS 10423.2D6ML5R57J5K5 10423.3599ETGBFMQMQ 10423.1EA7AAFW6OEPY 10423.5NZKYWXOABRYB 10423.4PXU24IV6JGQS 10423.5T6HXN1LWCQAY 10423.683YZV3YSAXYJ 10423.ZOMYCR0CE7XR 10423.1UBRAMXE9GIVA 10423.J821DNLC4S6X 10423.5JQXJ4Y9TJLYI 10423.4G0RGIMT97CY 10423.MHNF8VSPISIJ 10423.4XXMTLKY9Y2OI 10423.5CSEAC8XJHYEH 10423.2ZBSJ2T9K0UL7 10423.70V3NV3CALEP9 10423.6NDCRKGOFLIES 10423.10SPB51IEY5H4 10423.6KX9IX1ZBK5MH 10423.3GFK9KZ2USA96 10423.1RCNH1RG6R4A2 10423.1NCI6604JS69K 10423.2GQRATZFJY7SL 10423.6GRM2VASIW5NJ 10423.5OA2J6ZXL0DOP 10423.20EIA5SY1O1WU 10423.2JUFXVAL7WJAJ 10423.1P9LPN4HJBPC6 10423.66VS60G529IHE 10423.5PTWK1L6UUJYH 10423.4WOC4JZRZ4YBK 10423.5MSRJJN8MXBFQ 10423.2QFFV4RMUSYWV 10423.3QH9FD23S2R4N 10423.5APKKBDC55YF0 10423.72PO64Z4YDTR2 10423.300B96KDODYCK 10423.31K3II7T9VOFW 10423.2Z6JB21OHLFOE 10423.6FCT8NPR2DZC5 10423.5MT0GOVIQ6YHD 10423.4WXZMJTVMHQB0 10423.5PZMQLCF9N0VC 10423.1UM9QOGKEBCOW 10423.7EBRKQ9KEZU75 10423.640N4YYM6KM0D 10423.3D1SN4FQ5KBTC 10423.1SS4PTYV4FSLJ 10423.5FIJ0I75G130C 10423.5G49S9HF5DFP9 10423.30DKRT3HE3B5E 10423.5Y6CT8PL9Q3WI 10423.6V7WB0R6GKPFP 10423.1I5T8TNK6UMVC 10423.1FHHO6PZ6FX8L 10423.6YBSE3P29CGXO 10423.97FV1105FS41 10423.6I3NUHVWEJSZP 10423.3J0NT3X2XZEWN 10423.3HXZ4F94DN1DY 10423.6HFE1JD2DGC9Z 10423.7OS31IOJBDXM 10423.320DWMG1HVFCT 10423.2KXRJ7W90NJOZ 10423.3SK35DXP6ER44 10423.4GAPFS6QYN8F5 10423.5TE19PTH79M6X 10423.3SUUIKP5EJ7ZD 10423.6BV7K6Q11Q14I 10423.4NIECA9MPIDVC 10423.4KW5FNPLSRP7Q 10423.S9N1KZW9LUOU 10423.5QYNW6E455TB 10423.2A2RDUA68XM5E 10423.750R3WUJ39EO7 10423.42DDFPF570BB2 10423.KRUAPB0XMIA9 10423.4WGJVBZMKYFDY 10423.V1E3DJSC1LAW 10423.M6W224CHEBNA 10423.1OJJMX1XGA1QK 10423.3Y6KMK1XKSRBZ 10423.Q2PGMYQMDZSP 10423.2P661UNDE62N5 10423.4ODRZW68NLVIL 10423.53FKYF5J1JD19 10423.1SNDC3NU8JNS0 10423.2N6ZUD5GAYILE 10423.3ZMC9L36K79QP 10423.WLG5LWEUZ6J3 10423.1HSZ7MIJV250Y 10423.4RXEV9XYTHNNR 10423.7G9Y3MUD54U2C 10423.2729A09X9F0IE 10423.7INS3ZPOUUXYP 10423.240W84KLSED18 10423.12N8XNGE8KCFP 10423.F8K9B1QC643A 10423.3N55W228X3UVG 10423.66YR9Z7FW7GF1 10423.4EYWLATX6984M 10423.1A2INBWP8SKTH 10423.9LLTLXULF1VD 10423.5U8PNSPX4C1TL 10423.WQ9W79WJHQHG 10423.2BO68ESFFWJB1 10423.5OY4ARRED0FG0 10423.6SUC3KL1OAGO7 10423.BDX3LA9UW818 10423.74ANK36F1RK0Z 10423.7H0Q214UNT6PN 10423.L40TWDOWQEAI 10423.BN19DZ52XUT2 10423.1W0KQLL1OA8X0 10423.3AOXFL0LYQK0B 10423.1U395QPBFNAVZ 10423.4IASYZJBMAXIM 10423.76FBWQO7AO616 10423.3F4MD5BBJWBST 10423.5KCG9IH69SJP0 10423.2RU9L3TL5HDBH 10423.45JL3XYV6PQTT 10423.586I7P7C76NP2 10423.2841IQK53HH2L 10423.4YOERZVFSMFBT 10423.6EE0ZNNQWFOST 10423.37CT0IJU9LFNW 10423.8OFA39R6RQB4 10423.XN8EC6MP1N3A 10423.3SW0RFS32902Q 10423.5H0BUG0EKNFCL 10423.6973562WG8ICY 10423.36TBH1SXYKBUX 10423.56MP2M2ZRIPII 10423.47RO1ZM1NH5Q3 10423.31V3SU7JL9SCS 10423.6XDQ0RUZJ0VG1 10423.1RDTPWUDUGWDF 10423.Y43XLEQH3KPI 10423.18OW1ZELG06LG 10423.1PVCHEER8O213 10423.32HAXSCTIP83D 10423.4I810N2H7A6G6 10423.4K64ACVAWXDY 10423.2E7WZLKSV2C12 10423.4S0EV066HLTOM 10423.5ERR23WNXCQD1 10423.1NJ6K72XD70BD 10423.6TZRUU8XTHD64 10423.4WCGW6AZ68SKI 10423.66159U8DDYXZ2 10423.6NPWEIRUPO65X 10423.50MH4AG0B2AHR 10423.IWSTWFKXH18E 10423.2RUQJMT8HUFBJ 10423.1EBLKJA73HLRQ 10423.72NEXUFRK2KV4 10423.6EBRRD4DI4FWV 10423.6FV3XX92LFC3D 10423.2NOD7WU49JQAW 10423.1PO9IIHW5U96S 10423.4EG4XIAYAUTDC 10423.38HIW3ZSZ5N44 10423.6PYH6UVLCYV5H 10423.7GNXHXLEAGVWV 10423.6EGS28NOHA7S1 10423.2EEZYHHNXW4VD 10423.5D06JK92XOHC3 10423.2UGREVLW5HP0Q 10423.10WCTOF6Q2LEU 10423.4R9369QDQQ89 10423.5P3CN122L9M9L 10423.3FTSM27WB9PH1 10423.5TZ27SDSHIW 10423.18572H0Z05MSG 10423.56HNVZ2RY6PK4 10423.3V0O8BSYGZDZP 10423.4LPWI0RE5DZSO 10423.359ZAHO8V9FOF 10423.4XSMIQ1NASATC 10423.21YKCE5KKLN51 10423.5G573ZC2PTKQZ 10423.50A41MANBMUNF 10423.T062U23P0KAI 10423.7LS49U6B5TJDI 10423.6ATFBGFT7NKKB 10423.6J5762XU5CMI9 10423.4U750PNQABWNG 10423.4MX4J1Z0CJ36H 10423.62NULWOO141JA 10423.4TPP9HTH8SLQE 10423.2BQODUK2XHF8M 10423.5N5K3N6P09M8I 10423.6BDL9HT2ZV6DD 10423.7AVYRCY7KK1TS 10423.6ZFTV4INHQ6DT 10423.62TW9V6X1BKD 10423.46A39FK5RY8C9 10423.3C8IJADL5B38G 10423.6AYOJH7EA2ZH4 10423.2GMUV5DH5K4T8 10423.7QDBCKGVWOD4G 10423.2AP529I56OLQ2 10423.592JE49ESAF96 10423.7O2Q9321YC2AL 10423.2SQJOO3XTURX8 10423.5NR2U0PLGIJZ0 10423.22UTK6Z0ESTNK 10423.1ZIP54I8PNPB5 10423.3TQEQGRKN9XJF 10423.A3P2TUFZMYMK 10423.EL17S7QKVKIH 10423.3QXIXPTF5W9YC 10423.EM52Z535N9EA 10423.78CEKGBNG1H0K 10423.3WK9C15XNJX7U 10423.5BPA519ZVKE02 10423.7JAG7GUM4NFPC 10423.5WVVVC1HB77G7 10423.7CLYG6OSN3JYV 10423.1E2NY7O0VRITZ 10423.4SGFG7P7S5PGO 10423.6I9LH39UY5PWL 10423.1W3TNH1JFO1ZI 10423.1XVF1S619IJ3O 10423.1P2ZPA79SUYHX 10423.7590BNUBTSZLV 10423.YCC9KXMDGXJY 10423.39CNMKO4TZHPQ 10423.6O1MKIZIGOZ4I 10423.2ZMAZ4CFOVOET 10423.5909A294JSYA0 10423.4D8VFDHS59IXX 10423.MF59T457XWKY 10423.3D9K0KYYPKMNQ 10423.5SFPZ8R4DODNN 10423.4135EXZBBR1WE 10423.49M8K9HUB9KRW 10423.R6QXNSBURP8U 10423.3U4E4RILSLZDY 10423.6OJFFI29T71SG 10423.48DETQWBCTIF0 10423.7KNLUAD2L2RXB 10423.75KP0KGFMDLIU 10423.3MU5LQ2ILPQYK 10423.5BS17M9XGEWZA 10423.4ECWWEBDDN8E2 10423.45E2YRZ010OVD 10423.715E2IV56CTKG 10423.5CPN7R8ZYNFF9 10423.444AFFX9JOAF5 10423.2YLQGCQPGZ6ZL 10423.108TS5L6YS1U1 10423.3JT0L84KDSIFT 10423.LWT3FZ9QGCS4 10423.1LW4I8I36592B 10423.C10NOQ689WNL 10423.1UM1PAP757XQH 10423.1ZKQC1A8UVJ8O 10423.52E1MU3LAQJIP 10423.22OLE3VA2DJV 10423.24H5QHBX67VUX 10423.1NKRDWZXABR78 10423.5KN7MP8MHX0K9 10423.6N53JTGVP1XH4 10423.2J5G98JTR6DJ4 10423.1ALAB4FO46ZKR 10423.5A42PPBCJ38RQ 10423.6VPC28LFI40CR 10423.2W7NIUN3NZG1L 10423.4RDJCAHNDBK0O 10423.5K9G9S8YLODO5 10423.3GZFSKFEAYDW9 10423.7AF8AH78UDH01 10423.79PLP6IS58OCV 10423.5Z7VN66UOQQZ 10423.478MLADVUMVTY 10423.5Y93VTPIUKMVQ 10423.412XDK7Y2NMXZ 10423.7I6EQG10W9Q97 10423.6O3WOKZSP6G3O 10423.1T5N5LQ8XESG0 10423.73PDQUVSOS9C4 10423.1JSEC98R1JC4C 10423.K6LD8HBETFOM 10423.2X67QGXQKUBMI 10423.65AM8L65YK8DE 10423.1GJOIKXDK90O0 10423.2RFECZWKOH1JK 10423.2196O8PDYQHJI 10423.22WUR3R0K0NL3 10423.5VCR4TJICPR9Q 10423.6N7VI5XQ42OJK 10423.R3SAIEQRS7R 10423.3FSEBTDLEGIF9 10423.4R73VEN4N6D0I 10423.11DY8LV7XR82R 10423.7OQI7R4BSW8X1 10423.5OCTLRZV5UWNX 10423.7IAQMQXYE904A 10423.724O5TDPIUE72 10423.7M5VMR5Z2269M 10423.955QZ0PWYB4V 10423.4XFL1H9WU6CYX 10423.2SL1JI42O5PYS 10423.43B8CZMHSIGSO 10423.2CCF5LUCMTRXJ 10423.1FT5HBV64UB2C 10423.7HEYDH45WEVLT 10423.7RHCTLAH522KL 10423.3NCX9ILHH45PU 10423.3YCAT3T5ZL88U 10423.6FPUPWHHIZX6K 10423.5WMAR0CYQSIOB 10423.487NRFO63UTEX 10423.24SE2730QPEQ8 10423.7M2MPVPHAOD74 10423.39SFAMYW19QG5 10423.57H4JJR5LBI3J 10423.3H8LG9SXRRVSF 10423.43TR3MX6KN8IB 10423.HIGY7U6TBWX2 10423.29JBBH4TWCPE1 10423.320D0UZ4NP79L 10423.526A9DKCQQ8OB 10423.6232MYULUO0XP 10423.4BGK5E5CVSCS2 10423.5FWJAKF3FJCY3 10423.3HBCIUSVCMERN 10423.7IE63WK9GA13L 10423.241559SVVO02V 10423.7NXH12AGVWNDS 10423.342GV7MSMEI7D 10423.4ZQNZ95AZ1XW2 10423.WFAHMR329UNS 10423.5PZ5S2CRX9YVA 10423.5GKB98HDA3JKJ 10423.4QOL4RCFV1LAV 10423.7A6Z2Q7G3TW2D 10423.4ODI6ZH1Q60DQ 10423.6MX44Z69VY7OB 10423.VD9BR8L4XR1Y 10423.490GWQQNRQZZR 10423.2BDMWLSCGVHE7 10423.1D7K3IGLV3WBL 10423.SASEOLX35EOZ 10423.3NVXUGCQFS7IR 10423.319L2GON50UMA 10423.1722X621C82E1 10423.4JG8Q977RHU0J 10423.1C0RJWN31VNW8 10423.54X4V7QI2W2BV 10423.426YUL1JB1CE4 10423.2B6SUV3RHBBLJ 10423.6RUOWITZ0U4AP 10423.11UW5J8WSR8WJ 10423.5QCW97VIZCDO6 10423.645OBLYTZWLYR 10423.74KQIPBHSPIW5 10423.2LZJRY6GUQ096 10423.53ZHZBAIQHBSO 10423.4M7PCZU5HW2GM 10423.69PDUFM7Z9V46 10423.Y52QEUXZZWSU 10423.7Z1LXTKKWKPL 10423.12KZPCX0U93JR 10423.54HL8J744P8JV 10423.65PGKXM9LEC23 10423.3IWIGA2UGBOVN 10423.4I7S3HU740JEJ 10423.5P8US71XQYO81 10423.BOFJMTFZR1UU 10423.1ERV2W1IHB4LF 10423.3EM2QQJPXLBZY 10423.6P273AL8OLGJQ 10423.AX83T4V35U93 10423.3ZUCK6UP7H7MQ 10423.28MJDMDX1G0P0 10423.2PJOHMER752HM 10423.4KNNARHIYYH8F 10423.1123VZNBZ1AEX 10423.6B340UZNKWI1 10423.160SIQ8DOOVX4 10423.1235DA8PJATU7 10423.3TUK3ALT4XNKF 10423.3SEUT4N0Y5KAJ 10423.30AKS2V9PZ54J 10423.460I53VN7JJKD 10423.2WGU2BHJYZ60Z 10423.3HN7R8HO5IKIP 10423.775U289HVWNJM 10423.4WM20HZHQNHCE 10423.2XLDDMRPDW5KE 10423.ORRK7AZBI1CC 10423.4JELIV4MREZX4 10423.6ONKSBWIAURTG 10423.6GJDQVRWMIST3 10423.GXG24RUJM99U 10423.7AKZCSFE3C604 10423.1DY34RITAILX9 10423.58VOGM3WYK1DA 10423.4J93DP4RLPXYO 10423.542HZ1IQELHTJ 10423.78CNHLJXJB427 10423.XUZRSPV91XXO 10423.4O4EWY93CALP4 10423.24NT8QXT5GHTI 10423.2WTF6DEA7I0TQ 10423.2RE8ZWAJUXHJF 10423.NC3RY0VDHT6S 10423.2SFAH6VXF70YP 10423.VTQVHR9RUOU2 10423.3KRJX2YAGH5XI 10423.FFO3YFI9650T 10423.5N4P5LHMIRKEC 10423.5SNR5LZJV4JMW 10423.2VEEAS1VHWFJX 10423.8M61SQDSGHF6 10423.51B5IWW0VWE2P 10423.1WE424TCBFGUP 10423.3RQC30VWTSGJ6 10423.7LG102Q53TYO1 10423.13BRNR7ICXG72 10423.3N2DXPLEI33T0 10423.2KQ8754DPQNT0 10423.1GYIUXDH734CP 10423.2S502J44JFM3I 10423.TB5HEKX68G46 10423.6LW1RX3ZHIG5T 10423.2PN330K5EZVDP 10423.TQX5GVODIOUL 10423.4VL0J7E46DXX4 10423.7CY1PY4YP34OC 10423.E4ISA853SEN5 10423.6A9JSGZHRHGX8 10423.4A79GCK6KZ8F4 10423.6D35GW5KOHTK0 10423.2QTG56ZKUB8UM 10423.4OEFIPBPAM5FG 10423.1RO38T59W235E 10423.1RQUBE57GWM4M 10423.43EWRAH2XT4TM 10423.B70O6G3SDZ10 10423.5OV4B1J6OW9F5 10423.6AJ5SK4X62DSC 10423.1QN1RIJWBSJQ4 10423.728BOCRDTYU4S 10423.16JK6IRCK3AOE 10423.27WI6NS9SKL6M 10423.5WVEWT1TYU5G5 10423.7EKVQIYFN1GYZ 10423.6JBG0DVJY9CH 10423.D5QJA64XU43T 10423.2MVKYD8JFTRTA 10423.1SCD1RO3X5JV4 10423.9CO7ABODOYXM 10423.38W572OJCWBUE 10423.2MVB5GJCIDWOF 10423.6UJNDTP99NGT7 10423.31ZW2BZHBC59J 10423.6RLABO85GQZCW 10423.49SN5DVG78JOU 10423.3LD2NGH6WQ3O0 10423.3LD3J7Y3QWBR8 10423.666EHUZYGECVV 10423.APNAMRFTSRBI 10423.TNY1I4DJKQWY 10423.2EC8VWHQD1LW5 10423.54M4KVQRRHYEZ 10423.46YLZJB9WBC3M 10423.6ILPMM6XUBIPA 10423.HY8MA4Y0M5NH 10423.IPXWEA33QNCI 10423.7KBQLWO9S6M69 10423.O4OBR3WTUA4 10423.41RF7WI5CUIM4 10423.5HB37MRUSRW7U 10423.5FDIPMNUGVB56 10423.18IGL3K2PUZLA 10423.1UNFZJJI214S9 10423.5OABGC87OA0QC 10423.77RLPR0OFF8BR 10423.549C0S7BE5NM7 10423.6JT00IH0U317X 10423.4U5YRUKSMM4K3 10423.4OZ0XCZY6EY48 10423.7KLBQ8CSCLAY5 10423.3630H6I3S917O 10423.KSC4ZRL45SDJ 10423.4PESLFAPDP6UN 10423.45QCSQTXHSHR 10423.FCX1DFKOBM1L 10423.2HTWBWFA220A8 10423.3IFDZVMGL047S 10423.3DIYLFKS9NRLJ 10423.12K9TOP3EMEI2 10423.55KNWQKHU6LWO 10423.1265D0GX7EZV2 10423.1360LFZD3YR6Z 10423.5G6RXP92MYBMU 10423.49B89XI3ZVGV0 10423.5HBZNL5LJ1T6C 10423.71TEYC5P46N8J 10423.480BVEJ0XRDIZ 10423.7K527VLGYRS4G 10423.4Z5TNG8RZZI5N 10423.60QSTYI4PWYN4 10423.31R0TOIW6K5JC 10423.4LX6WYAZD18N0 10423.6YCR6X59S8T10 10423.Z353QP0QBIAH 10423.14R8WJEXAM4IJ 10423.3WSQL5X3N6X3X 10423.1Q8MVSERSJMX5 10423.1XXX77XOR3F19 10423.4LHED4JBBKRTD 10423.5ZER2BX0U9BAY 10423.2VHMBW1GF40J7 10423.D0HB9EJVEP70 10423.4GWH3AXXI5T7A 10423.3A0NMMHRXN3AL 10423.5DYGY9UIX3HS5 10423.7EFVFNF4NVP3T 10423.229ATTG3YJVX2 10423.6CYR6X323KGHD 10423.4MOOR0TEBCAC0 10423.46FUBQSB0WXCC 10423.74NHLABFDK1VD 10423.5P63PM206458T 10423.5ZXHUCZ2VHHZ0 10423.G7CIB3QI4EMM 10423.2BJDYX0HPU6EA 10423.5J8DWQ6O78M5N 10423.2AF3KQYME6TWI 10423.LO4E9LDLZWW0 10423.Y9M2RELMSMNY 10423.78LK85P6WUYWQ 10423.56X7INM5WDJC4 10423.DYL5OU6K6HQ9 10423.5VS3BGG66351P 10423.6ZHH2IL8HT0H8 10423.22RTKGQSQONMP 10423.3WNHD55IKRI74 10423.2QXIL5SGZM6D 10423.W36C3U0641V3 10423.4V8FF5HDXV34D 10423.2758DZ183CYG1 10423.1SHV6XNZ2ULTK\n", "GTAGGTGAACCTGCGGAAGGATCATTAATAGTGCCCTCTGACGCAAG... 265.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 245.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 473.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0\n", "GTAGGTGAACCTGCGGAGGGATCATTACCGAGCGAGGGCCCCCGGGC... 0.0 1133.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 9.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 60.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 15.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 845.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 26.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 26.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 27.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 6.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 49.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 3.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 17.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 134.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0\n", "GTAGGTGAACCTGCGGAAGGATCATTACCGAGTTAGGGTCTTCTAGG... 0.0 408.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0\n", "GTAGGTGAACCTGCGGAAGGATCATTACAGTTATTACTTTCTACCAG... 0.0 330.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 14.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 9.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0" ] }, "execution_count": 3, "metadata": {}, "output_type": "execute_result" } ], "source": [ "import pandas as pd\n", "\n", "feature_table_raw = pd.read_csv('data/feature_table.tsv', sep = '\\t', )\n", "feature_table_raw.head()" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### How do we interpret this data?\n", "\n", "\n", "[See this link](https://blogs.iu.edu/ncgas/2021/09/17/introduction-to-illumina-sequencing/) for some nice graphics giving a basic overview of how a genetic sequencing machine works:\n", "\n", "
\n", "
\n", "\n", "Illumina Sequencing\n", "\n", "\n", "\n", "Source: Indiana University\n", "\n", "
\n", "
\n" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "The [BIOM file format](http://biom-format.org/) is commonly found in -omics datasets where it is used to represent OTU tables. \n", "\n", "OTUs stand for [Operational Taxonomic Units](https://en.wikipedia.org/wiki/Operational_taxonomic_unit) which can be thought of as clusters of organisms grouped by genetic sequence similarity of a particular region of the genome. \n", "\n", "In essence, they act as a proxy for “species” at different taxonomic levels when the clusters of organisms are unknown. \n", "\n", "The observations or rows in this table are OTUs and the corresponding matrix records the number of times each OTU is observed in each sample." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### Converting these sequences to corresponding organisms using BLAST\n", "\n", "
\n", "
\n", "\n", "\n", "\n", "Source: BLAST Glossary\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Since the scientists who originally collected this data most likely took swabs of various surfaces and locations and then sequenced the DNA of the microorganisms and fungi that were picked up by this swab, we don’t necessarily know the composition of the actual species beforehand. \n", "\n", "All we have are different groups of strings of DNA (composed of A, T, C, Gs) from which we can then compare to a reference database by running the BLAST local alignment search algorithm on it.\n", "\n", "Such a tool can be [found here](https://blast.ncbi.nlm.nih.gov/Blast.cgi) offered by the NIH. In our case, this step was already done for us." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "Source: Wikipedia - Sequence Alignment\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### Data Preprocessing" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Fortunately, our dataset already came with a corresponding metadata file with information regarding sample ids, location where the sequencing was performed, the type of experiment the data came from, the sequencing machine used, the timestamps of the swab collection, the geolocation, and much more. \n", "\n", "#### Finding corresponding ground truth of geolocation\n", "\n", "We can open our metadata file in pandas by doing the following:" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "sample_table = pd.read_csv('data/mapping_files/60899_mapping_file.txt', sep = '\\t')" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Converting .BIOM file to Feature Table\n", "\n", "We can then create a helper function that takes the output from our .biom file and converts it to something that is easier to work with, which we’ll call a feature table:" ] }, { "cell_type": "code", "execution_count": 5, "metadata": {}, "outputs": [], "source": [ "def convert_tsv(df):\n", " \"\"\"\n", " Helper function to take the output of the biom-format package from a .biom file\n", " Converts it to a feature table\n", " \"\"\"\n", " length = df.shape[0]\n", " df = df.reset_index().T\n", " df.set_index(0)\n", " \n", " # We remove the DNA sequence for an encoding, taking less space\n", " new_header = ['Sample_id'] + list(range(length-1))\n", " df = df[1:]\n", " df.columns = new_header\n", " df = df.reset_index().drop('index', axis=1)\n", " \n", " return df" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Then we can run our above helper function on our previous raw table and rename our index:" ] }, { "cell_type": "code", "execution_count": 7, "metadata": {}, "outputs": [], "source": [ "feature_table = convert_tsv(feature_table_raw)\n", "feature_table = feature_table.set_index('Sample_id').astype(float).astype(int)\n", "\n", "print(feature_table.shape)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "We can see that we start with a table that has 1,497 rows and 25,756 columns. \n", "\n", "Because each column represents a particular genetic sequence or OTU (which corresponds to our features or dimensions), we can see that we are dealing with incredibly high-dimensional data. This is quite common when dealing with metagenomic data sets and presents new challenges that traditional data science techniques may not be able to handle." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Dealing with High-Dimensional Data \n", "\n", "Problem: Overabundance of Columns or Features\n", "\n", "Solution*:\n", "1) Make column names shorter\n", "2) Thresholding to get a subset of the data" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Solution Part 1 - To help us deal with this high dimensionality, we used our helper function to rename every column that was originally labeled with a genetic sequence to a corresponding integer, so that we don’t have really long strings of genetic sequences as column names. Each of these columns contains either frequencies or counts of that particular OTU for each row. Each row represents a sample id that might identify for example a particular swab." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Solution Part 2 - From here we can undergo a few common practices used to clean bioinformatics data. By making sure each sequence has more than 20,000 reads associated with it and has been seen in at least 3 different samples (in essence, applying a series of thresholds), we can subset our data such that we now have 301 rows and 1,894 columns." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "*Note that there is much that can be improved upon at this step, and many scientific papers have been written about this. We are approaching this from a quick-and-dirty perspective." ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "# Make sure the sequence has more than 20,000 reads total\n", "feature_table = feature_table.loc[(feature_table.sum(axis='columns') > 20000)]\n", "\n", "# Make sure the sequence has been seen in at least 3 different samples\n", "feature_table = feature_table[feature_table.columns[((feature_table > 0).sum() > 3)]]\n", "\n", "# Check dimensions of our data\n", "print(feature_table.shape)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Since we applied thresholds to reduce our feature table, we will also remove those corresponding entries from our metadata table:" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "# Subset sample table\n", "sample_table = sample_table.set_index('#SampleID')\n", "sample_table = sample_table.loc[feature_table.index]" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "From here we can now use our metadata to double-check and see that we have samples that come from 3 different cities:" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "sample_table['city'].drop_duplicates()" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Next Steps...\n", "\n", "We have walked through the steps explaining the nature of microbiome metagenomic data, how to obtain it, how to load it, and how to preprocess it and get it into a format from which we can now do analysis on.\n", "\n", "In the next half of this tutorial, we’ll show you how to apply various machine learning algorithms and dimensionality reducing techniques to help visualize and interpret high dimensional data so that we can infer an underlying geographic structure from our data without having to resort to labels provided via our metadata." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### Dimensionality Reduction & Visualization\n" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Purpose:\n", "\n", "Unsupervised machine learning methods can allow us to understand and explore data in situations where we are not given explicit labels. One type of unsupervised machine learning methods falls under the family of clustering. Getting a general idea of groups or clusters of similar data points can inform us of any underlying structural patterns in our data, such as geography, functional similarities, or communities when we otherwise would not know this information beforehand.\n", "\n", "We will be applying our dimensional reduction techniques to Microbiome data acquired from UCSD’s Qiita platform. This will then allow us to apply clustering and other machine learning techniques." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "*Brief Reminder: Our microbiome dataset has columns that represent counts of bacterial DNA sequences present, and our rows represent samples of individual communities of bacteria.* " ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "Source: Pexels - modified by user\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Bacterial communities are expected to be unique across the three different locations, and we hope to visualize that through the high-dimensional microbiome data. " ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Representing high-dimensional data in two dimensions\n", "\n", "To visualize this complex, sparse, and high dimensional metagenomic data as something our eyes can interpret on a two-dimensional computer screen, we will be needing to drastically reduce our dimension size, or in other words, the number of features in our data. \n", "\n", "Rather than the 25,000 columns of our dataset which currently represent a portion of the genetic sequence of each organism and their counts in our microbiome, we instead would like a notion of “the most important features” to plot. \n", "\n", "We will explores 3 different dimensionality reduction and visualization techniques applied to microbiome data and explains what these visualizations can tell us about the structure inherent in our data." ] }, { "cell_type": "code", "execution_count": 9, "metadata": {}, "outputs": [], "source": [ "import pandas as pd\n", "import matplotlib.pyplot as plt\n", "import seaborn as sns" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Assigning color as ground truth labels\n", "\n", "For demonstration purposes, since we actually do have labels for this data set, we can confirm whether or not our data set produces nice visualizations by assigning a different color to each point corresponding to a different geographic location. In reality, you will often not have this if you are already taking the unsupervised machine learning approach." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### 1 - Principal Component Analysis (PCA)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Our first dimensionality reduction technique and one of the most commonly used ones is called [Principal Component Analysis (PCA)](https://en.wikipedia.org/wiki/Principal_component_analysis). \n", "\n", "PCA attempts to reduce the feature space down to representations of the variation found within the data. It does this by taking all of your data points and rotating to an axis that clearly shows the maximum amount of variability. That axis is known as your ‘first principal component’. Mathematically speaking, the placement of this line goes through the centroid of your data, while also minimizing the squared distance of each point to that line. It is also the axis with the most variation in the data. " ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "PCA Explained\n", "\n", "\n", "\n", "Source: prwatech\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "After re-aligning our data, we will then collapse all data points onto that dimension. Once this step is done, we rinse and repeat, keeping in mind that every time we find a new principal component, that new line will always be perpendicular to the previous principal component. \n", "\n", "[See here](https://setosa.io/ev/principal-component-analysis/) for a nice visual explanation of PCA.\n", "\n", "To do PCA we can run the following code on our previously built feature table from Part 1 of our series." ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "from sklearn.decomposition import PCA\n", "\n", "pca = PCA(n_components=2)\n", "principalComponents = pca.fit_transform(np.array(feature_table))\n", "plot_df = pd.DataFrame(data = principalComponents, columns = ['dim1', 'dim2'], index = feature_table.index)\n", "\n", "# We can then plot this like so:\n", "sns.scatterplot(x = 'dim1', y = 'dim2', data = plot_df)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "And if we are given labels to check how our dimensionality reduction went (reminder that in reality this is not guaranteed), we can replot our PCA with colors:" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "plot_df = pd.concat([plot_df, sample_table['city']], axis = 1)\n", "\n", "sns.scatterplot(x = 'dim1', y = 'dim2', hue = 'city', data = plot_df)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Problems with PCA\n", "\n", "When we transform our data from 1,894 features down to 2, we can see two discernable dimensions the data is being placed into. \n", "\n", "However, once we look at the true meaning of the data after the geographic origin of the data has been revealed, we see that this visualization technique doesn’t give us a good representation of the geographic data. \n", "\n", "Unfortunately, this common technique falls apart when applied to the level of sparsity that microbiome data produces.\n", "\n", "**It is important to note that after applying PCA we could get a variety of shapes for our plots. To interpret the different shapes you can get, we recommend you check out this post [here](https://www.nxn.se/valent/2017/6/12/how-to-read-pca-plots).*" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### 2 - t-Distributed Stochastic Neighborhood Embedding (t-SNE)\n", "\n", "Another technique used to explore high-dimensional data like our microbiome data is to use something known as [t-distributed stochastic neighbor embedding t-SNE](https://jmlr.org/papers/volume9/vandermaaten08a/vandermaaten08a.pdf). \n", "\n", "Unlike PCA which works by trying to keep dissimilar data points far apart in our lower-dimensional representations using linear methods, t-SNE attempts to handle data that lie on non-linear lower-dimensional manifolds by trying to keep similar data points close together." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "t-SNE Explained\n", "\n", "\n", "\n", "Source: Nuancesprog\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "t-SNE works by minimizing the divergence between 2 distributions:\n", "1) The first distribution comes from our pairwise similarities of objects in our original high-dimensional input space. \n", "2) The second distribution is that of our pairwise similarities of objects in our corresponding lower-dimensional embedding. \n", "\n", "In essence, we are trying to minimize the divergence between these two distributions of our original high dimensional space and the corresponding lower-dimensional one." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "To run t-SNE let’s use the implementation by scikit-learn and run that on our feature table from before:" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "from sklearn.manifold import TSNE\n", "\n", "tsne = TSNE(metric = 'jaccard', perplexity=30.0)\n", "embeddings = tsne.fit_transform(feature_table)\n", "\n", "plot_df = pd.DataFrame(data = embeddings, columns = ['dim1', 'dim2'], index = feature_table.index)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Important Assumptions of t-SNE\n", "\n", "**1) Distance Metric**: One of our parameters for t-SNE is the metric we used to calculate the distances between our instances of our features. \n", "\n", "The default is Euclidean distance, but since we are using counts as our entries for each row, we will instead use a metric called the Jaccard distance. \n", "\n", "In essence, the Jaccard distance metric is the number of counts in two sets divided by the number in either set, multiplied by 100, and then subtracting this all from 1. It technically measures the *dissimilarity* between sample sets.\n", "\n", "
\n", "
\n", "\n", "Comparison of Different Distance Metrics\n", "\n", "\n", "\n", "Source: Towards Data Science\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "**2) Perplexity**: This allows us to balance how much we would like to emphasize our local vs. global relationships in our data. \n", "\n", "We chose to stick with the default setting of perplexity=30, however we highly recommend this exploration of t-SNE and perplexity [here](https://distill.pub/2016/misread-tsne/).\n", "\n", "
\n", "
\n", "\n", "t-SNE vs. PCA\n", "\n", "\n", "\n", "Source: Towards Data Science\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Our t-SNE plots\n", "\n", "Let us plot the results from our t-SNE embedding, showing both a plot without labels (again, like how you would expect in real unsupervised scenarios) and a plot with our known labels:" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "sns.scatterplot(x = 'dim1', y = 'dim2', data = plot_df)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "
\n", "
\n", "\n", "\n", "
\n", "
\n", "\n", "\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "When the labels are revealed, we can see that this embedding is a decent representation of the underlying geographic structure present in our microbiome genetic data as evidenced by the data points taken from the same geographic region being separated in their own (tri?)quadrants." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "### Uniform Approximation and Projection (UMAP)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "The last dimensionality reduction technique we will use to represent our high dimensional microbiome metagenomic data is called Uniform Approximation and Projection (UMAP). \n", "\n", "UMAP improves upon t-SNE’s performance by not only working better with larger datasets in a markedly shorter time but also by preserving much more of the original global structure of our data. \n", "\n", "For a nice in-depth comparison of t-SNE vs. UMAP, we recommend [this tutorial here](https://towardsdatascience.com/how-exactly-umap-works-13e3040e1668)." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "Source: Towards Data Science\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "The mathematical underpinnings of UMAP center around first building a weighted graph, where edge weights represent the likelihood of a connection between points. This is determined by a radius that expands out from each point and connecting points with overlapping radii. As each point’s radius grows, its likelihood of connection decreases." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "#### Assumptions of UMAP\n", "\n", "**1) Local vs. Global Structure**: Our *n_neighbors* parameter corresponds to the number of nearest neighboring points used to construct our original graph, with low values emphasizing local structure, and high values emphasizing global structure.\n", "\n", "**2) Minimum Distance**: The *min_dist* parameter represents the minimum distance we would like between points in our lower-dimensional embedding, with low values giving us more closely packed groups of points, and larger values giving more loosely packed groups of points.\n", "\n", "I recommend playing around with the [interactive visualizations here](https://pair-code.github.io/understanding-umap/) to get an intuitive feel for UMAP’s hyperparameters." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "Let’s now create our new lower-dimensional embedding with UMAP:" ] }, { "cell_type": "code", "execution_count": null, "metadata": {}, "outputs": [], "source": [ "import umap\n", "\n", "reducer = umap.UMAP(n_components = 2, n_neighbors = 15, metric = 'jaccard', random_state = 0)\n", "embeddings = reducer.fit_transform(feature_table)\n", "plot_df = pd.DataFrame(data = embeddings, columns = ['dim1', 'dim2'], index = feature_table.index)\n", "\n", "# Like before, we can plot our lower dimensional embedding without labels:\n", "sns.scatterplot(x = 'dim1', y = 'dim2', data = plot_df)" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "
\n", "
\n", "\n", "\n", "\n", "
\n", "
\n", "\n", "
\n", "
\n", "\n", "\n", "\n", "
\n", "
" ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "As we can see once we apply colors to reveal our labels, it seems that UMAP does a much better job at conveying the underlying geographic structure from our original high-dimensional metagenomic data set to the above lower-dimensional visualization, with each “spoke” or “petal” of the plot representing that area’s local community of microorganisms, also known as those microbiomes." ] }, { "attachments": {}, "cell_type": "markdown", "metadata": {}, "source": [ "---\n", "\n", "## Conclusion\n", "\n", "Microbiome data present a unique challenge due to its inherently high-dimensional and sparse nature. To reduce dimensionality we applied three techniques: PCA, t-SNE, and UMAP. In terms of grouping similar data such as microbial samples with a similar geographic origin, UMAP performed the best.\n", "\n", "#### Where to go from here?\n", "\n", "Following up on the above, we can use these 2D embeddings combined with our favorite clustering algorithms to infer classes from the data. Instead of specifying dimensionality reduction down to two dimensions, we can try to reduce it down to any number of dimensions and then apply clustering on top of that. \n", "\n", "This clustering can then allow us to create \"labels\" from which we can then feed into a supervised learning framework like a neural network. " ] }, { "cell_type": "markdown", "metadata": {}, "source": [] } ], "metadata": { "kernelspec": { "display_name": "venv", "language": "python", "name": "python3" }, "language_info": { "codemirror_mode": { "name": "ipython", "version": 3 }, "file_extension": ".py", "mimetype": "text/x-python", "name": "python", "nbconvert_exporter": "python", "pygments_lexer": "ipython3", "version": "3.9.6" }, "orig_nbformat": 4 }, "nbformat": 4, "nbformat_minor": 2 }