[434ac6]: / README.md

Download this file

13 lines (9 with data), 1.1 kB

genomics

Deep learning in genomics

CCGAGGGCTATGGTTTGGAAGTTAGAACCCTGGGGCTTCTCGCGGACACC

The notebooks in this repository are based on the jupyter notebook from the publication "A primer on deep learning in genomics" but use the PyTorch and fastai library.

Notebooks
* Basic model with PyTorch
* Basic model with PyTorch and fastai
* Custom ResNet model with PyTorch and fastai