--- a
+++ b/2-Transcriptome/README.md
@@ -0,0 +1,121 @@
+
+
+## 1. Software and database required
+
+**Software:**
+
+- Cutadapt (v2.5): https://cutadapt.readthedocs.io/en/stable/
+- Hisat2 (v2.1.0): https://daehwankimlab.github.io/hisat2/
+- RSEM (v1.3.3): https://deweylab.github.io/RSEM/
+- DESeq2 (v1.20): https://bioconductor.org/packages/release/bioc/html/DESeq2.html
+
+**Database:**
+
+- RSEM reference database（GRch38）https://www.gencodegenes.org/human/
+
+## 2. Data preparation
+
+**Create directories and copy raw sequencing files：**
+
+```shell
+mkdir 00_rawdata 01_fastp 02_cutadapt 03_rsem
+mv *.fastq 00_rawdata
+cd 00_rawdata/
+ls *_1.fastq.gz > ../filelist
+cd ..
+```
+
+## 3. Quality filtering
+
+**Adapter sequence detection：**
+
+```shell
+for i in `cat filelist`
+do
+	j=${i/_1./_2.}
+	fastp \
+	--detect_adapter_for_pe \
+	-i 00_rawdata/$i \
+	-I 00_rawdata/$j \
+	-o 01_fastp/$i \
+	-O 01_fastp/$j \
+	-z 4 -q 20 -u 40 -n 6
+done
+```
+
+**Remove adapter：**
+
+```shell
+for i in `cat filelist`
+do
+	j=${i/_1./_2.}
+	cutadapt \
+	--discard-trimmed \
+	-O 18 \
+	-j 20 \
+	-b AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
+	-B AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
+	-o 02_cutadapt/$i \
+	-p 02_cutadapt/$j \
+	00_rawdata/$i \
+	00_rawdata/$j 
+done
+```
+
+## 4. Sequence alignment and gene expression calculation
+
+**Install RSEM:**
+
+```shell
+wget https://github.com/deweylab/RSEM/archive/v1.3.3.tar.gz
+tar -zxvf v1.3.3.tar.gz
+cd rsem
+make install prefix=/software/biosoft/rsem/ 
+echo 'PATH=$PATH:/software/biosoft/rsem/bin/' >> ~/.bashrc
+source ~/.bashrc
+```
+
+**Build index：**
+
+```shell
+rsem-prepare-reference \
+-p 20 \
+--gtf \
+./gencode.v39.annotation.gtf \
+--hisat2-hca \
+./GRCh38.primary_assembly.genome.fa \
+./grch38
+```
+
+**Align RNA-seq against human genome and calculate gene expression:**
+
+```shell
+for i in `cat filelist`
+do
+	j=${i/_1./_2.}
+	k=${i%%_*}
+	rsem-calculate-expression \
+	--paired-end \
+	-p 20 \
+	--hisat2-hca \
+	02_cutadapt/$i \
+	02_cutadapt/$j \
+	/software/biosoft/rsem/database/grch38/grch38 \
+	03_rsem/$k
+done
+```
+
+The count and FPKM data of all genes in each sample should be present in [SampleID].genes.results
+
+Concatenate the results of each sample to generate the file count.txt
+
+## 5. Variance stabilizing transformation of count data
+
+```R
+data<-read.table("count.txt",row.names=1,sep="\t",header=T)
+group<-read.table("group.txt",sep="\t",header=T) ## optional metadata
+dds <- DESeqDataSetFromMatrix(countData = data, colData = group, design= ~ Group)
+vst<-assay(varianceStabilizingTransformation(dds))
+write.table(vst,"transcriptome.txt",append=FALSE,sep="\t",quote=FALSE)
+```
+